View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0942_high_24 (Length: 456)
Name: NF0942_high_24
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0942_high_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 6e-81; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 6e-81
Query Start/End: Original strand, 30 - 301
Target Start/End: Original strand, 1418495 - 1418744
Alignment:
| Q |
30 |
aaaacaattatatatgttttgattaattattagttatgaannnnnnnnncatataatacatgattgagggatattgtcgtgtatttatatatgatgttat |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1418495 |
aaaacaattatatatgttttgattaattattagttgtga-tttttttttcatataatacatgattgagggatattgtcgtgtatttatatatgatgttat |
1418593 |
T |
 |
| Q |
130 |
gttatactgaactttaatctttgtttgaaagatagtaatttgttgtttataaaagagatccatttacgtatgtatatgaattgtttaaaaggtagtataa |
229 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
1418594 |
gttatactgaactttaatctttgtttcaaagatagtaatttgttgtttataaaagagatccatttacgtatcta---------------------tataa |
1418672 |
T |
 |
| Q |
230 |
tataatgttcggaatcggttcatatttgatgaattgttgaaccgacttgaattgtttaaaagctaaaaattg |
301 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1418673 |
tataatgttcggaaccggttcatatttgatgaattgttgaaccgacttgaattgtttaaaagctaaaaattg |
1418744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 8e-25
Query Start/End: Original strand, 384 - 446
Target Start/End: Original strand, 1418893 - 1418955
Alignment:
| Q |
384 |
attttaggtatttctttcacaatgcacattgcctttgacaccatatgactgactatattcatc |
446 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1418893 |
attttaggtctttctttcacaatgcacattgcctttgacaccatatgactgactatattcatc |
1418955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University