View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0942_high_74 (Length: 312)
Name: NF0942_high_74
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0942_high_74 |
 |  |
|
[»] scaffold0190 (1 HSPs) |
 |  |  |
|
[»] scaffold0065 (1 HSPs) |
 |  |  |
|
[»] scaffold0337 (1 HSPs) |
 |  |  |
|
[»] scaffold0171 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 103; Significance: 3e-51; HSPs: 7)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 110 - 303
Target Start/End: Original strand, 26797052 - 26797263
Alignment:
Q |
110 |
ttaatggatttcttaacaagtacagcgcttaagatcgaagttgtatacttgacttcaattacaaaatcgaccttttaagaggtctgaaacaactttccta |
209 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||| |||||| ||||| | |||||||||||||||| |
|
|
T |
26797052 |
ttaatggatttcttaacaagtacaacgcttaagatcgaagttgtatacttgacttcagttacaaaatcaaccttt-aagagatttgaaacaactttccta |
26797150 |
T |
 |
Q |
210 |
gtgt-------------------atgtcaatctgtgtctccttaatccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagact |
290 |
Q |
|
|
||| ||||||||| ||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
26797151 |
gtggcttcagccttctctagtgaatgtcaatccatgtctccttgatccttcacttgatgtcttgttttgtcgatttacatgatatctctctaaaaagact |
26797250 |
T |
 |
Q |
291 |
caaacacctatga |
303 |
Q |
|
|
||||||||||||| |
|
|
T |
26797251 |
caaacacctatga |
26797263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 235 - 294
Target Start/End: Original strand, 26387791 - 26387850
Alignment:
Q |
235 |
atccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactcaaa |
294 |
Q |
|
|
||||||||||||||||||||||| | ||||||||||||| |||| |||||||||||||| |
|
|
T |
26387791 |
atccttcacttgatgtcttgtttagctgatttacatgatttctcattaaaaagactcaaa |
26387850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 45 - 87
Target Start/End: Complemental strand, 29346682 - 29346640
Alignment:
Q |
45 |
ttggaaagaatatgcacactctttaaggctgcagcataatgga |
87 |
Q |
|
|
||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
29346682 |
ttggaaagaatctgcacactctttaaggctgcagcataatgga |
29346640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 235 - 293
Target Start/End: Complemental strand, 26297915 - 26297857
Alignment:
Q |
235 |
atccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactcaa |
293 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||| | || ||||| |||||||| |
|
|
T |
26297915 |
atccttcacttgatgtcttgttttgccgatttacatgatttatcactaaatagactcaa |
26297857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 229 - 278
Target Start/End: Complemental strand, 10341961 - 10341912
Alignment:
Q |
229 |
tccttaatccttcacttgatgtcttgttttgttgatttacatgatatctc |
278 |
Q |
|
|
|||||||||||||||||||||| | | |||||||||||||||||| |||| |
|
|
T |
10341961 |
tccttaatccttcacttgatgtttggatttgttgatttacatgatttctc |
10341912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 235 - 294
Target Start/End: Complemental strand, 11475015 - 11474955
Alignment:
Q |
235 |
atccttcacttgatgtcttgttttgttgatttacatgatatctctct-aaaaagactcaaa |
294 |
Q |
|
|
|||||||| ||||||||||||||| |||||||||||| |||| || ||||||||||||| |
|
|
T |
11475015 |
atccttcatgtgatgtcttgttttgccgatttacatgatttctcactaaaaaagactcaaa |
11474955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 229 - 273
Target Start/End: Complemental strand, 16970636 - 16970592
Alignment:
Q |
229 |
tccttaatccttcacttgatgtcttgttttgttgatttacatgat |
273 |
Q |
|
|
||||| ||||||||| |||||||||| ||||| |||||||||||| |
|
|
T |
16970636 |
tccttgatccttcacatgatgtcttgatttgtcgatttacatgat |
16970592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 5e-19; HSPs: 15)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 235 - 295
Target Start/End: Original strand, 13583466 - 13583526
Alignment:
Q |
235 |
atccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactcaaac |
295 |
Q |
|
|
|||||||||||||||||||||||||| |||||||||||| |||| |||||||||||||||| |
|
|
T |
13583466 |
atccttcacttgatgtcttgttttgtcgatttacatgatttctcactaaaaagactcaaac |
13583526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 235 - 302
Target Start/End: Original strand, 28260236 - 28260304
Alignment:
Q |
235 |
atccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactc-aaacacctatg |
302 |
Q |
|
|
||||| ||| ||||||||||||||| ||||||||||||| |||| |||||||||||| ||||||||||| |
|
|
T |
28260236 |
atcctccacgtgatgtcttgttttgctgatttacatgatttctcactaaaaagactcaaaacacctatg |
28260304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 239 - 294
Target Start/End: Complemental strand, 11437583 - 11437528
Alignment:
Q |
239 |
ttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactcaaa |
294 |
Q |
|
|
||||||||||||||||||||| |||||||||||| |||| ||||||||||||||| |
|
|
T |
11437583 |
ttcacttgatgtcttgttttgccgatttacatgatttctcactaaaaagactcaaa |
11437528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 44 - 98
Target Start/End: Original strand, 8831485 - 8831539
Alignment:
Q |
44 |
tttggaaagaatatgcacactctttaaggctgcagcataatggagagatgatttg |
98 |
Q |
|
|
|||||||||||| ||||||||||||| |||||||||| |||||||||| |||||| |
|
|
T |
8831485 |
tttggaaagaatctgcacactctttagggctgcagcagaatggagagaggatttg |
8831539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 229 - 302
Target Start/End: Complemental strand, 28074687 - 28074613
Alignment:
Q |
229 |
tccttaatccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactc-aaacacctatg |
302 |
Q |
|
|
||||| |||||||| |||||||||||||||| ||||||||||| |||| |||||||||||| ||||||||||| |
|
|
T |
28074687 |
tccttgatccttcatttgatgtcttgttttgcatatttacatgatttctcactaaaaagactcgaaacacctatg |
28074613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 44 - 98
Target Start/End: Original strand, 28225979 - 28226033
Alignment:
Q |
44 |
tttggaaagaatatgcacactctttaaggctgcagcataatggagagatgatttg |
98 |
Q |
|
|
|||||||||||| | ||||||||||| |||||||||| ||||||||||||||||| |
|
|
T |
28225979 |
tttggaaagaatctacacactctttagggctgcagcagaatggagagatgatttg |
28226033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 247 - 302
Target Start/End: Complemental strand, 31436635 - 31436579
Alignment:
Q |
247 |
atgtcttgttttgttgatttacatgatatctctctaaaaagactc-aaacacctatg |
302 |
Q |
|
|
||||||||||||||||||||||||||| |||| ||||||||| || ||||||||||| |
|
|
T |
31436635 |
atgtcttgttttgttgatttacatgatttctcactaaaaagattcaaaacacctatg |
31436579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 238 - 294
Target Start/End: Complemental strand, 12357638 - 12357582
Alignment:
Q |
238 |
cttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactcaaa |
294 |
Q |
|
|
||||||||||||||||||||| ||||||||| || |||| ||||||||||||||| |
|
|
T |
12357638 |
cttcacttgatgtcttgtttttcagatttacataatttctcactaaaaagactcaaa |
12357582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 238 - 294
Target Start/End: Complemental strand, 12358766 - 12358710
Alignment:
Q |
238 |
cttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactcaaa |
294 |
Q |
|
|
||||||||||||||||||||| ||||||||| || |||| ||||||||||||||| |
|
|
T |
12358766 |
cttcacttgatgtcttgtttttcagatttacataatttctcactaaaaagactcaaa |
12358710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 235 - 294
Target Start/End: Complemental strand, 5153926 - 5153867
Alignment:
Q |
235 |
atccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactcaaa |
294 |
Q |
|
|
||||||||||| ||||||||||||| ||||||||||| ||| ||||||||||||||| |
|
|
T |
5153926 |
atccttcactttatgtcttgttttgcctatttacatgatttcttactaaaaagactcaaa |
5153867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 252 - 294
Target Start/End: Original strand, 6888156 - 6888198
Alignment:
Q |
252 |
ttgttttgttgatttacatgatatctctctaaaaagactcaaa |
294 |
Q |
|
|
|||||||||||||||||||||| |||| |||||| |||||||| |
|
|
T |
6888156 |
ttgttttgttgatttacatgatttctcactaaaatgactcaaa |
6888198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 44 - 85
Target Start/End: Complemental strand, 29368989 - 29368948
Alignment:
Q |
44 |
tttggaaagaatatgcacactctttaaggctgcagcataatg |
85 |
Q |
|
|
|||||||||||| |||||||| ||||||||||||||| |||| |
|
|
T |
29368989 |
tttggaaagaatctgcacactttttaaggctgcagcagaatg |
29368948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 235 - 302
Target Start/End: Original strand, 14424759 - 14424827
Alignment:
Q |
235 |
atccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaaga-ctcaaacacctatg |
302 |
Q |
|
|
||||||| |||| |||||||||||| |||||||||||| |||| ||||||| | || ||||||||||| |
|
|
T |
14424759 |
atccttcccttgttgtcttgttttgccgatttacatgatttctcactaaaaaaacctaaaacacctatg |
14424827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 234 - 286
Target Start/End: Original strand, 27097745 - 27097797
Alignment:
Q |
234 |
aatccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaa |
286 |
Q |
|
|
||||| |||| ||||||||||||||| |||||||||||| |||| ||||||| |
|
|
T |
27097745 |
aatccatcacgtgatgtcttgttttgccgatttacatgatttctcactaaaaa |
27097797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 238 - 294
Target Start/End: Complemental strand, 29291935 - 29291879
Alignment:
Q |
238 |
cttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactcaaa |
294 |
Q |
|
|
|||||| |||| |||||||||| |||||||||||| ||| ||||||||||||||| |
|
|
T |
29291935 |
cttcacgtgatatcttgttttgccgatttacatgatttcttactaaaaagactcaaa |
29291879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 8)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 229 - 301
Target Start/End: Original strand, 20461588 - 20461661
Alignment:
Q |
229 |
tccttaatccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactc-aaacacctat |
301 |
Q |
|
|
||||| ||||||||||||||||||| ||||| |||||||||||| |||| |||||||||||| |||||||||| |
|
|
T |
20461588 |
tccttgatccttcacttgatgtcttattttgccgatttacatgatttctcactaaaaagactcgaaacacctat |
20461661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 238 - 294
Target Start/End: Original strand, 8308981 - 8309037
Alignment:
Q |
238 |
cttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactcaaa |
294 |
Q |
|
|
|||||| ||||||||||||||| ||||||||||||| ||| ||||||||||||||| |
|
|
T |
8308981 |
cttcacgtgatgtcttgttttgctgatttacatgatttcttactaaaaagactcaaa |
8309037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 235 - 294
Target Start/End: Original strand, 3487312 - 3487371
Alignment:
Q |
235 |
atccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactcaaa |
294 |
Q |
|
|
|||||||| |||||||||||||||| |||| ||||||| |||| |||||||||||||| |
|
|
T |
3487312 |
atccttcatttgatgtcttgttttgccgattcacatgatttctcattaaaaagactcaaa |
3487371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 229 - 302
Target Start/End: Original strand, 5312726 - 5312800
Alignment:
Q |
229 |
tccttaatccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactc-aaacacctatg |
302 |
Q |
|
|
||||| |||||||||||||||| | ||||| |||||||||||| | || |||||||||||| ||||||||||| |
|
|
T |
5312726 |
tccttgatccttcacttgatgtttatttttgccgatttacatgatttatcactaaaaagactcaaaacacctatg |
5312800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 273
Target Start/End: Original strand, 7777985 - 7778023
Alignment:
Q |
235 |
atccttcacttgatgtcttgttttgttgatttacatgat |
273 |
Q |
|
|
||||||||| |||||||||| |||||||||||||||||| |
|
|
T |
7777985 |
atccttcacgtgatgtcttgctttgttgatttacatgat |
7778023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 229 - 273
Target Start/End: Complemental strand, 7815498 - 7815454
Alignment:
Q |
229 |
tccttaatccttcacttgatgtcttgttttgttgatttacatgat |
273 |
Q |
|
|
||||| ||||||||| ||||||||| |||||||||||||||||| |
|
|
T |
7815498 |
tccttgatccttcacatgatgtctttatttgttgatttacatgat |
7815454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 229 - 273
Target Start/End: Original strand, 9761355 - 9761399
Alignment:
Q |
229 |
tccttaatccttcacttgatgtcttgttttgttgatttacatgat |
273 |
Q |
|
|
||||| ||||||||| |||||||||| ||||| |||||||||||| |
|
|
T |
9761355 |
tccttgatccttcacgtgatgtcttgatttgtcgatttacatgat |
9761399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 229 - 273
Target Start/End: Complemental strand, 10292929 - 10292885
Alignment:
Q |
229 |
tccttaatccttcacttgatgtcttgttttgttgatttacatgat |
273 |
Q |
|
|
||||| ||||||||| |||||||||| |||| ||||||||||||| |
|
|
T |
10292929 |
tcctttatccttcacatgatgtcttgatttgatgatttacatgat |
10292885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 9)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 229 - 290
Target Start/End: Complemental strand, 9288384 - 9288323
Alignment:
Q |
229 |
tccttaatccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagact |
290 |
Q |
|
|
||||| ||||||||||||||||||||||||| |||||||||||| |||| ||||||||||| |
|
|
T |
9288384 |
tccttgatccttcacttgatgtcttgttttgccgatttacatgatttctcactaaaaagact |
9288323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 235 - 302
Target Start/End: Original strand, 31859847 - 31859915
Alignment:
Q |
235 |
atccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactc-aaacacctatg |
302 |
Q |
|
|
||||||||| || |||||||||||| ||||||||||||| |||| |||||||||||| ||||||||||| |
|
|
T |
31859847 |
atccttcacctggtgtcttgttttgctgatttacatgatttctcactaaaaagactcaaaacacctatg |
31859915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 44 - 99
Target Start/End: Complemental strand, 19852341 - 19852286
Alignment:
Q |
44 |
tttggaaagaatatgcacactctttaaggctgcagcataatggagagatgatttga |
99 |
Q |
|
|
|||||||||||| ||||||||||||| |||||||||| |||||||||| ||||||| |
|
|
T |
19852341 |
tttggaaagaatttgcacactctttagggctgcagcagaatggagagaggatttga |
19852286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 229 - 294
Target Start/End: Complemental strand, 26159930 - 26159865
Alignment:
Q |
229 |
tccttaatccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactcaaa |
294 |
Q |
|
|
|||| |||||||||| ||||||||||||||| |||| |||||||| | || ||||||||||||||| |
|
|
T |
26159930 |
tcctgaatccttcacatgatgtcttgttttgctgatctacatgatttttcactaaaaagactcaaa |
26159865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 229 - 303
Target Start/End: Complemental strand, 17187347 - 17187274
Alignment:
Q |
229 |
tccttaatccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactcaaacacctatga |
303 |
Q |
|
|
|||| |||| |||||||||||| || |||||| |||||||||||| | || |||||||||||| ||||||||||| |
|
|
T |
17187347 |
tcctcaatcattcacttgatgtgttattttgtcgatttacatgatttatcactaaaaagactc-aacacctatga |
17187274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 236 - 294
Target Start/End: Complemental strand, 23353789 - 23353731
Alignment:
Q |
236 |
tccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactcaaa |
294 |
Q |
|
|
||||||| ||||||||||||||| |||||||||||| |||| ||||||||||||||| |
|
|
T |
23353789 |
tccttcatgtgatgtcttgttttgccgatttacatgatttctcactaaaaagactcaaa |
23353731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 229 - 302
Target Start/End: Complemental strand, 15192378 - 15192303
Alignment:
Q |
229 |
tccttaatccttcacttgatgtcttgttttgttgatttacatgatatctctcta-aaaagactc-aaacacctatg |
302 |
Q |
|
|
||||| ||||||||| |||||||||| ||||| |||||||||||| |||| ||| |||| |||| ||||||||||| |
|
|
T |
15192378 |
tccttgatccttcacgtgatgtcttggtttgtcgatttacatgatttctcactacaaaacactcaaaacacctatg |
15192303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 235 - 294
Target Start/End: Complemental strand, 29437639 - 29437580
Alignment:
Q |
235 |
atccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactcaaa |
294 |
Q |
|
|
||||||||| ||||||||||| ||| |||||||||||| |||| |||||||||||||| |
|
|
T |
29437639 |
atccttcacgtgatgtcttgtcttgccgatttacatgatttctcattaaaaagactcaaa |
29437580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 235 - 294
Target Start/End: Original strand, 34864241 - 34864301
Alignment:
Q |
235 |
atccttcacttgatgtcttgttttgttgatttacatgatatctctcta-aaaagactcaaa |
294 |
Q |
|
|
||||||||| |||||||||| ||||| |||||||||||| |||| ||| |||| ||||||| |
|
|
T |
34864241 |
atccttcacgtgatgtcttgatttgtcgatttacatgatttctcactacaaaacactcaaa |
34864301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000002; HSPs: 8)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 237 - 294
Target Start/End: Complemental strand, 24617677 - 24617620
Alignment:
Q |
237 |
ccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactcaaa |
294 |
Q |
|
|
||||||| ||||||||||||||| |||||||||| || |||| ||||||||||||||| |
|
|
T |
24617677 |
ccttcacatgatgtcttgttttgctgatttacataatttctcactaaaaagactcaaa |
24617620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 229 - 294
Target Start/End: Original strand, 9396547 - 9396611
Alignment:
Q |
229 |
tccttaatccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactcaaa |
294 |
Q |
|
|
||||| ||||||||| ||||||||||||||| |||||| ||||| |||| ||||||||||||||| |
|
|
T |
9396547 |
tccttgatccttcacgtgatgtcttgttttgccgattta-atgatttctcactaaaaagactcaaa |
9396611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 245 - 294
Target Start/End: Complemental strand, 16439616 - 16439567
Alignment:
Q |
245 |
tgatgtcttgttttgttgatttacatgatatctctctaaaaagactcaaa |
294 |
Q |
|
|
|||||||||||||| ||||||||||||| |||| ||||||||||||||| |
|
|
T |
16439616 |
tgatgtcttgtttttctgatttacatgatttctcactaaaaagactcaaa |
16439567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 245 - 294
Target Start/End: Original strand, 14768225 - 14768274
Alignment:
Q |
245 |
tgatgtcttgttttgttgatttacatgatatctctctaaaaagactcaaa |
294 |
Q |
|
|
||||||||||||||| |||||||||||| ||| ||| |||||||||||| |
|
|
T |
14768225 |
tgatgtcttgttttgccgatttacatgatttctatctgaaaagactcaaa |
14768274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 245 - 294
Target Start/End: Original strand, 32930429 - 32930478
Alignment:
Q |
245 |
tgatgtcttgttttgttgatttacatgatatctctctaaaaagactcaaa |
294 |
Q |
|
|
||||||||||||||| ||||||||||| |||| ||||||||||||||| |
|
|
T |
32930429 |
tgatgtcttgttttgccaatttacatgatttctcactaaaaagactcaaa |
32930478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 238 - 294
Target Start/End: Original strand, 14924367 - 14924423
Alignment:
Q |
238 |
cttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactcaaa |
294 |
Q |
|
|
||||| |||||||||||||| | || |||||||||| |||| || |||||||||||| |
|
|
T |
14924367 |
cttcatttgatgtcttgtttagctggtttacatgatttctcacttaaaagactcaaa |
14924423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 234 - 278
Target Start/End: Original strand, 24507387 - 24507431
Alignment:
Q |
234 |
aatccttcacttgatgtcttgttttgttgatttacatgatatctc |
278 |
Q |
|
|
|||||||||| |||||||||| |||||||||||||| ||| |||| |
|
|
T |
24507387 |
aatccttcacgtgatgtcttgatttgttgatttacaggatttctc |
24507431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 229 - 285
Target Start/End: Original strand, 33638445 - 33638501
Alignment:
Q |
229 |
tccttaatccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaa |
285 |
Q |
|
|
||||| |||||||||||||| | |||||||| |||||||||||| |||| |||||| |
|
|
T |
33638445 |
tccttgatccttcacttgatatattgttttgccgatttacatgatttctcactaaaa |
33638501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 9)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 229 - 294
Target Start/End: Original strand, 19763833 - 19763898
Alignment:
Q |
229 |
tccttaatccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactcaaa |
294 |
Q |
|
|
||||| || ||||||||||||||| |||||| |||||||||||| |||| ||||||||||||||| |
|
|
T |
19763833 |
tccttgattcttcacttgatgtctcgttttgccgatttacatgatttctcactaaaaagactcaaa |
19763898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 229 - 294
Target Start/End: Complemental strand, 26070648 - 26070583
Alignment:
Q |
229 |
tccttaatccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactcaaa |
294 |
Q |
|
|
||||| |||||||| ||||||||||||||| ||||||||||| |||| ||||||||||||||| |
|
|
T |
26070648 |
tccttgatccttcatgtgatgtcttgttttgccaatttacatgatttctcactaaaaagactcaaa |
26070583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 235 - 294
Target Start/End: Complemental strand, 20694808 - 20694749
Alignment:
Q |
235 |
atccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactcaaa |
294 |
Q |
|
|
|||||||| ||||||||||||||| |||||||||||| ||| ||||||||||||||| |
|
|
T |
20694808 |
atccttcatatgatgtcttgttttgccgatttacatgatttcttactaaaaagactcaaa |
20694749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 235 - 273
Target Start/End: Complemental strand, 22229973 - 22229935
Alignment:
Q |
235 |
atccttcacttgatgtcttgttttgttgatttacatgat |
273 |
Q |
|
|
||||||||| |||||||||| |||||||||||||||||| |
|
|
T |
22229973 |
atccttcacgtgatgtcttgatttgttgatttacatgat |
22229935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 245 - 294
Target Start/End: Original strand, 24279582 - 24279631
Alignment:
Q |
245 |
tgatgtcttgttttgttgatttacatgatatctctctaaaaagactcaaa |
294 |
Q |
|
|
|||||||||||||||| |||||| ||||| |||| |||||| |||||||| |
|
|
T |
24279582 |
tgatgtcttgttttgtcgatttatatgatttctcactaaaatgactcaaa |
24279631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 245 - 294
Target Start/End: Complemental strand, 24382632 - 24382583
Alignment:
Q |
245 |
tgatgtcttgttttgttgatttacatgatatctctctaaaaagactcaaa |
294 |
Q |
|
|
|||||||||||||||| |||||| ||||| |||| |||||| |||||||| |
|
|
T |
24382632 |
tgatgtcttgttttgtcgatttatatgatttctcactaaaatgactcaaa |
24382583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 229 - 273
Target Start/End: Original strand, 12339954 - 12339998
Alignment:
Q |
229 |
tccttaatccttcacttgatgtcttgttttgttgatttacatgat |
273 |
Q |
|
|
||||| ||||||||| |||||||||| |||||||||||| ||||| |
|
|
T |
12339954 |
tccttgatccttcacgtgatgtcttgatttgttgatttatatgat |
12339998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 229 - 273
Target Start/End: Original strand, 25075252 - 25075296
Alignment:
Q |
229 |
tccttaatccttcacttgatgtcttgttttgttgatttacatgat |
273 |
Q |
|
|
||||| ||||||||| |||||||||| |||| ||||||||||||| |
|
|
T |
25075252 |
tccttgatccttcacatgatgtcttgatttgatgatttacatgat |
25075296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 229 - 273
Target Start/End: Original strand, 25133221 - 25133265
Alignment:
Q |
229 |
tccttaatccttcacttgatgtcttgttttgttgatttacatgat |
273 |
Q |
|
|
||||| ||||||||| |||||||||| |||| ||||||||||||| |
|
|
T |
25133221 |
tccttgatccttcacatgatgtcttgatttgatgatttacatgat |
25133265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000002; HSPs: 8)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 235 - 303
Target Start/End: Original strand, 17415109 - 17415178
Alignment:
Q |
235 |
atccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactc-aaacacctatga |
303 |
Q |
|
|
||||||||| ||||||||||||||| |||||||| ||| |||| |||||||||||| |||||||||||| |
|
|
T |
17415109 |
atccttcacgtgatgtcttgttttgccgatttacacgatttctcactaaaaagactcaaaacacctatga |
17415178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 235 - 302
Target Start/End: Complemental strand, 19541205 - 19541137
Alignment:
Q |
235 |
atccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactc-aaacacctatg |
302 |
Q |
|
|
||||||||||||||||||| ||||| |||||||||||| |||| ||| |||||||| ||||||||||| |
|
|
T |
19541205 |
atccttcacttgatgtcttattttgccgatttacatgatttctcactagaaagactcaaaacacctatg |
19541137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 229 - 290
Target Start/End: Complemental strand, 18818871 - 18818810
Alignment:
Q |
229 |
tccttaatccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagact |
290 |
Q |
|
|
||||||||||||||| ||||| ||||||||| |||||||||||| |||| |||||||||| |
|
|
T |
18818871 |
tccttaatccttcacgtgatgccttgttttgccgatttacatgatttctcaataaaaagact |
18818810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 229 - 273
Target Start/End: Complemental strand, 1733266 - 1733222
Alignment:
Q |
229 |
tccttaatccttcacttgatgtcttgttttgttgatttacatgat |
273 |
Q |
|
|
||||||||||||||| |||||||||| |||| ||||||||||||| |
|
|
T |
1733266 |
tccttaatccttcacgtgatgtcttgctttgatgatttacatgat |
1733222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 230 - 294
Target Start/End: Complemental strand, 39730620 - 39730556
Alignment:
Q |
230 |
ccttaatccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactcaaa |
294 |
Q |
|
|
|||| |||||||| ||||||||||||||| ||||||| ||||| |||| ||||||| ||||||| |
|
|
T |
39730620 |
ccttgatccttcatgtgatgtcttgttttgctgatttatatgatttctcactaaaaatactcaaa |
39730556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 231 - 294
Target Start/End: Complemental strand, 1732723 - 1732660
Alignment:
Q |
231 |
cttaatccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactcaaa |
294 |
Q |
|
|
|||||||||||| |||||||||||||||| ||||||||||| ||| | ||||||||||||| |
|
|
T |
1732723 |
cttaatccttcatgtgatgtcttgttttgtcaatttacatgatttcttaccaaaaagactcaaa |
1732660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 235 - 294
Target Start/End: Original strand, 18236249 - 18236308
Alignment:
Q |
235 |
atccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactcaaa |
294 |
Q |
|
|
|||||||| ||||||||||||||| || ||||||||| |||| ||||||||||||||| |
|
|
T |
18236249 |
atccttcatgtgatgtcttgttttgccgagttacatgatttctcactaaaaagactcaaa |
18236308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 294
Target Start/End: Original strand, 15454479 - 15454544
Alignment:
Q |
229 |
tccttaatccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactcaaa |
294 |
Q |
|
|
||||| |||||||| ||||||||||||||| | ||||||| ||| |||| ||||||| ||||||| |
|
|
T |
15454479 |
tccttgatccttcatgtgatgtcttgttttgctaatttacacgatttctcactaaaaaaactcaaa |
15454544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 38; Significance: 0.000000000002; HSPs: 8)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 229 - 294
Target Start/End: Complemental strand, 26102231 - 26102166
Alignment:
Q |
229 |
tccttaatccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactcaaa |
294 |
Q |
|
|
||||| ||| ||||| |||||||||||||||| ||||| || |||||||| ||||||||||||||| |
|
|
T |
26102231 |
tccttgatcattcacgtgatgtcttgttttgtcgatttgcacgatatctcactaaaaagactcaaa |
26102166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 44 - 87
Target Start/End: Original strand, 13062195 - 13062238
Alignment:
Q |
44 |
tttggaaagaatatgcacactctttaaggctgcagcataatgga |
87 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||| |||||| |
|
|
T |
13062195 |
tttggaaagaatctgcacactctttaaggctgcagcagaatgga |
13062238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 44 - 80
Target Start/End: Complemental strand, 39332220 - 39332184
Alignment:
Q |
44 |
tttggaaagaatatgcacactctttaaggctgcagca |
80 |
Q |
|
|
|||||||||||| |||||||||||||||||||||||| |
|
|
T |
39332220 |
tttggaaagaatctgcacactctttaaggctgcagca |
39332184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 245 - 303
Target Start/End: Complemental strand, 18795339 - 18795280
Alignment:
Q |
245 |
tgatgtcttgttttgttgatttacatgatatctctctaaaaagactc-aaacacctatga |
303 |
Q |
|
|
||||||||||||||| ||||||||| ||| |||| |||||| ||||| |||||||||||| |
|
|
T |
18795339 |
tgatgtcttgttttgctgatttacacgatttctcactaaaatgactcaaaacacctatga |
18795280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 229 - 294
Target Start/End: Complemental strand, 25126654 - 25126589
Alignment:
Q |
229 |
tccttaatccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactcaaa |
294 |
Q |
|
|
|||| |||||||||| ||||||||| |||| | ||||||||||| |||| |||||||||||||| |
|
|
T |
25126654 |
tcctcaatccttcacgtgatgtcttatttttctaatttacatgatttctcattaaaaagactcaaa |
25126589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 229 - 273
Target Start/End: Original strand, 8247597 - 8247641
Alignment:
Q |
229 |
tccttaatccttcacttgatgtcttgttttgttgatttacatgat |
273 |
Q |
|
|
||||| ||| ||||| |||||||||| |||||||||||||||||| |
|
|
T |
8247597 |
tccttgatctttcacgtgatgtcttgatttgttgatttacatgat |
8247641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 235 - 294
Target Start/End: Original strand, 26854266 - 26854323
Alignment:
Q |
235 |
atccttcacttgatgtcttgttttgttgatttacatgatatctctctaaaaagactcaaa |
294 |
Q |
|
|
||||||||||| ||||||||||||| | |||||||| || |||||||||||||||||| |
|
|
T |
26854266 |
atccttcacttaatgtcttgttttgccggtttacatg--atttctctaaaaagactcaaa |
26854323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 229 - 273
Target Start/End: Complemental strand, 30781935 - 30781891
Alignment:
Q |
229 |
tccttaatccttcacttgatgtcttgttttgttgatttacatgat |
273 |
Q |
|
|
||||| ||||||||| |||||||||| |||| ||||||||||||| |
|
|
T |
30781935 |
tccttgatccttcacatgatgtcttgatttgatgatttacatgat |
30781891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0190 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: scaffold0190
Description:
Target: scaffold0190; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 234 - 273
Target Start/End: Original strand, 11643 - 11682
Alignment:
Q |
234 |
aatccttcacttgatgtcttgttttgttgatttacatgat |
273 |
Q |
|
|
||||||| ||||||||||||||||||| |||||||||||| |
|
|
T |
11643 |
aatccttaacttgatgtcttgttttgtcgatttacatgat |
11682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0065 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0065
Description:
Target: scaffold0065; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 234 - 302
Target Start/End: Complemental strand, 12414 - 12344
Alignment:
Q |
234 |
aatccttcacttgatgtcttgttttgttgatttacatgatatctctcta-aaaagactc-aaacacctatg |
302 |
Q |
|
|
|||||||||| |||||||||| ||||| |||||||||||| |||| ||| |||| |||| ||||||||||| |
|
|
T |
12414 |
aatccttcacgtgatgtcttgatttgtcgatttacatgatttctcactacaaaacactcaaaacacctatg |
12344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0337 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0337
Description:
Target: scaffold0337; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 234 - 278
Target Start/End: Complemental strand, 1978 - 1934
Alignment:
Q |
234 |
aatccttcacttgatgtcttgttttgttgatttacatgatatctc |
278 |
Q |
|
|
|||||||||| |||||||||| |||||||||||||| ||| |||| |
|
|
T |
1978 |
aatccttcacgtgatgtcttgatttgttgatttacaggatttctc |
1934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0171 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0171
Description:
Target: scaffold0171; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 229 - 273
Target Start/End: Complemental strand, 6370 - 6326
Alignment:
Q |
229 |
tccttaatccttcacttgatgtcttgttttgttgatttacatgat |
273 |
Q |
|
|
||||| ||||||||| |||||||||| ||||| |||||||||||| |
|
|
T |
6370 |
tccttgatccttcacgtgatgtcttgatttgtcgatttacatgat |
6326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University