View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0942_high_84 (Length: 296)
Name: NF0942_high_84
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0942_high_84 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 193 - 267
Target Start/End: Complemental strand, 35377582 - 35377508
Alignment:
Q |
193 |
atatagctttaggtctatttgttcaggtggagtggaggaggtagttgaattgcctatgaaaaataatgtcatatt |
267 |
Q |
|
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35377582 |
atataactttaggtctatttgttcaggtggagtggaggaggtagttgaattgcctatgaaaaataatgtcatatt |
35377508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 25 - 120
Target Start/End: Complemental strand, 35377749 - 35377655
Alignment:
Q |
25 |
gaatatgacctaccaatagannnnnnnattgttgtcgttggttgtggggaaatagtgtttacctacctcattcaatagttactgggttcagttcag |
120 |
Q |
|
|
|||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
35377749 |
gaatatgacctaccaatagatttttt-attgctgtcgttggttgtggggaaatagtgtttacctagctcattcaatagttactgggttcagttcag |
35377655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University