View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0942_high_87 (Length: 283)
Name: NF0942_high_87
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0942_high_87 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 5e-99; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 52 - 254
Target Start/End: Original strand, 7211606 - 7211808
Alignment:
| Q |
52 |
tcagatcccctttagcaaaatgaaggataatcgaatccaaaatagccaaatatgaataggcttaaattggaaggtgagattcactattaaccctaccata |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7211606 |
tcagatcccctttagcaaaatgaaggataatcaaatccaaaatagccaaatatgaatagatttaaattggaaggtgaaattcactattaaccctaccata |
7211705 |
T |
|
| Q |
152 |
tttcatcaaatttagagcattcaaaagccctatggcttcacctatatccatttcaaaaattggcaagaaccactcactttttgtaagcacaaaatgacta |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7211706 |
tttcatcaaatttagagcattcaaaagccctatggcttcacctatatccatttaaaaaattggcaagaaccactcactttttgtaagcacaaaatgacta |
7211805 |
T |
|
| Q |
252 |
ttg |
254 |
Q |
| |
|
||| |
|
|
| T |
7211806 |
ttg |
7211808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 22 - 59
Target Start/End: Original strand, 7211606 - 7211643
Alignment:
| Q |
22 |
tcagatcccctttagcaaaatgaaggataatcagatcc |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7211606 |
tcagatcccctttagcaaaatgaaggataatcaaatcc |
7211643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University