View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0942_low_100 (Length: 296)
Name: NF0942_low_100
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0942_low_100 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 268
Target Start/End: Original strand, 6564870 - 6565136
Alignment:
| Q |
1 |
tgccatagtctaaacttgcgtactcgtggtcaatttgattttcaccgaaactcatggactacttaagtctaaccacttggttttgaatataggcttctca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6564870 |
tgccatagtctaaacttgcgtactcgtggtcaatttgattttcaccgaaactcatcgactacttaagtctaaccacttggttttgaatataggcttctca |
6564969 |
T |
 |
| Q |
101 |
tgaagtaacataacatctcttagaaaaattgagaaaaataagaaattggtttaaaagcataacataaactaagtcttactttaacagtgaggaatgatgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
6564970 |
tgaagtaacataacatctcttagaaaaattgagaaaaataagaaattggtttaaaagcataacataaactaagt-ttactttaacagtgaggaatgatgt |
6565068 |
T |
 |
| Q |
201 |
tttaattccaaatctgagaactatgttatttcatttctcatgagaaacatatagtctttgtccttcct |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6565069 |
tttaattccaaatctgagaactatgttatttcatttctcatgagaaacatatagtctttgtccttcct |
6565136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University