View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0942_low_107 (Length: 281)
Name: NF0942_low_107
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0942_low_107 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 47 - 222
Target Start/End: Complemental strand, 30360272 - 30360096
Alignment:
| Q |
47 |
tatttccctctttaattcttttatatcgtggttctaa-gttttggctgatcatcttaaggcacatggtttagtttgccgtttgcttttgtgttggttgcc |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30360272 |
tatttccctctttaattcttttatatcgtggttctaaagttttggctgatcatcttaaggcacatggtttagtttgccgtttgcttttgtgttggttgcc |
30360173 |
T |
 |
| Q |
146 |
ttactaatctaaagtttagtcgagaggttaataagatccgatcaaaaattgtttcaaacggaaattgaagaatctta |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30360172 |
ttactaatctaaagtttagtcgagaggttaataagatccgatcaaaaattgtttcaaacggaaattgaagaatctta |
30360096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University