View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0942_low_112 (Length: 276)
Name: NF0942_low_112
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0942_low_112 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 49522422 - 49522525
Alignment:
| Q |
1 |
tcttgagtttcttgataccttgctggataaaaccccatccttcttcaaagttgataatctttgacatgttggtgaattgag--agctgcaatgaaatatt |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
49522422 |
tcttgagtttcttgataccttgctggataaaaccccatccttcttcaaagttgataatctttgacatgttggtgaattgagaaagctgcaatgaaatatt |
49522521 |
T |
 |
| Q |
99 |
gatt |
102 |
Q |
| |
|
|||| |
|
|
| T |
49522522 |
gatt |
49522525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 193 - 262
Target Start/End: Original strand, 49522634 - 49522699
Alignment:
| Q |
193 |
gaaagtttgtttgatgcaaagcgaagttaacctatagctatgcatgccttttgatcgttttatagcaaca |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
49522634 |
gaaagtttgtttgatgcaaagcgaagttaacctatagct----atgccttttgatcgttttatagcaaca |
49522699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University