View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0942_low_112 (Length: 276)

Name: NF0942_low_112
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0942_low_112
NF0942_low_112
[»] chr4 (2 HSPs)
chr4 (1-102)||(49522422-49522525)
chr4 (193-262)||(49522634-49522699)


Alignment Details
Target: chr4 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 49522422 - 49522525
Alignment:
1 tcttgagtttcttgataccttgctggataaaaccccatccttcttcaaagttgataatctttgacatgttggtgaattgag--agctgcaatgaaatatt 98  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||    
49522422 tcttgagtttcttgataccttgctggataaaaccccatccttcttcaaagttgataatctttgacatgttggtgaattgagaaagctgcaatgaaatatt 49522521  T
99 gatt 102  Q
    ||||    
49522522 gatt 49522525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 193 - 262
Target Start/End: Original strand, 49522634 - 49522699
Alignment:
193 gaaagtttgtttgatgcaaagcgaagttaacctatagctatgcatgccttttgatcgttttatagcaaca 262  Q
    |||||||||||||||||||||||||||||||||||||||    |||||||||||||||||||||||||||    
49522634 gaaagtttgtttgatgcaaagcgaagttaacctatagct----atgccttttgatcgttttatagcaaca 49522699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University