View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0942_low_113 (Length: 276)
Name: NF0942_low_113
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0942_low_113 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 96 - 247
Target Start/End: Original strand, 6890342 - 6890492
Alignment:
Q |
96 |
aaaaagagtcaatgaggggacacacacactaacttgcccttcttttctgcannnnnnnncttagtgaagaggggaggaaagataagcaaaagcagccatg |
195 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
6890342 |
aaaaagagtcaatgaggggacacacacactaacttgcccttcttttctgcattttttt-cttagtgaagaggagaggaaagataagcaaaagcagccatg |
6890440 |
T |
 |
Q |
196 |
tatttgaaaaatagtgatgtggggcccactaatgtcttacatataataacat |
247 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6890441 |
tatttgaaaaatagtgatgtggggcccactaatgtcttacatataataacat |
6890492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 7 - 68
Target Start/End: Original strand, 6890253 - 6890314
Alignment:
Q |
7 |
gtgagatgaagtgttaaatactctaacttacttgtattttggtgtatgattaaaccaaacac |
68 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6890253 |
gtgacatgaagtgttaaatactctaacttacttgtattttggtgtatgattaaaccaaacac |
6890314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University