View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0942_low_117 (Length: 269)
Name: NF0942_low_117
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0942_low_117 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 29 - 269
Target Start/End: Complemental strand, 36650169 - 36649931
Alignment:
Q |
29 |
gatgaagagttgaagctcacagttttggccgatggcgcgtatgatttgtgtttcacacacaaaattaatagtcatgtgttgcaagctattaaattcttct |
128 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36650169 |
gatgaagagttgaagctcacagttttggccgatggcgcgtacgatttgtgtttcacacacaaaattaatagtcatgtgttgcaagctattaaattcttct |
36650070 |
T |
 |
Q |
129 |
agggatgtctacaaaacagaaaactatattggaatttcattcagtaacaatgtatcttctgtatgtttagaaattgaaatttctgtactatgaatttctt |
228 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
36650069 |
agggatgtctacaaaacag--aactatattggaatttcattcagtaacaatgtatcttctgtatgtttacaaattgaaatttctgtactatgaatttctt |
36649972 |
T |
 |
Q |
229 |
tgatatggaaacagtaatttcaaaaatttctactgtatgtt |
269 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36649971 |
tgatatggaaacagtaatttcaaaaatttctactgtatgtt |
36649931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University