View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0942_low_121 (Length: 267)
Name: NF0942_low_121
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0942_low_121 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 145 - 257
Target Start/End: Complemental strand, 8823144 - 8823032
Alignment:
| Q |
145 |
gtgatttttactaaagcatttaagttcagttgaagtatatgaaaaacacaataaatgtaagtttatttatatgtaagcagcatgttggtttggtttgaaa |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8823144 |
gtgatttttactaaagcatttaagttcagttgaagtatatgaaaaacacaataaatgtaagtttatttatatgtaagcagcatgttggtttggtttgaaa |
8823045 |
T |
 |
| Q |
245 |
tctggtgtctctg |
257 |
Q |
| |
|
||||||||||||| |
|
|
| T |
8823044 |
tctggtgtctctg |
8823032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 1 - 112
Target Start/End: Complemental strand, 8823288 - 8823177
Alignment:
| Q |
1 |
tacacaagacaaaaacaagaagaagaagaaacgccaaacaacgaggtaacaagtttgctgaaacagcagccattgttgtatatggtttgtaacttgcaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8823288 |
tacacaagacaaaaacaagaagaagaaaaaacgccaaacaacgaggtaacaagtttgctgaaacagcagccattgttgtatatggtttgtaacttgcaag |
8823189 |
T |
 |
| Q |
101 |
ctagttaatctt |
112 |
Q |
| |
|
|||||||||||| |
|
|
| T |
8823188 |
ctagttaatctt |
8823177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University