View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0942_low_126 (Length: 263)
Name: NF0942_low_126
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0942_low_126 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 94 - 234
Target Start/End: Original strand, 37433596 - 37433736
Alignment:
Q |
94 |
ataaactactaaataaatgaactgacgttattgaagcagtcataaatccgataatatggtactcaccatatctgtcctatagggacattcccaactaacc |
193 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
37433596 |
ataaattactaaataaatgaactgacgttattgaagcagtcagaaatccaataatatggtactcaccatatctgtcctatagagacattcccaactaacc |
37433695 |
T |
 |
Q |
194 |
tatttaaaattagactataaactactattaagtgcaaaaag |
234 |
Q |
|
|
||||| |||||||||||||||||| |||||||||||||||| |
|
|
T |
37433696 |
tattttaaattagactataaactagtattaagtgcaaaaag |
37433736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 13 - 77
Target Start/End: Original strand, 37433399 - 37433463
Alignment:
Q |
13 |
gatgcattgaccactttaagtcttgtataagaactcacgttttgtctttagttaaaagacgtctc |
77 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||| |||||||| |||||||||||||||||| |
|
|
T |
37433399 |
gatgcattgaccactttaagtcttgtataagacctcaagttttgtccttagttaaaagacgtctc |
37433463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University