View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0942_low_130 (Length: 254)
Name: NF0942_low_130
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0942_low_130 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 2970238 - 2970497
Alignment:
Q |
1 |
gttcgtgctagtccaaaatctccaatctaataat-----cacgaaagaaaaatattagtcttaacaaaattcaactgttctttgtttggatgttttcatt |
95 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
2970238 |
gttcgtgctagtccaaaatctccaatctaataatttcatcacgaaagaaaagtattagtcttaacaaaattcaactgttctttgtttggatgttttcatt |
2970337 |
T |
 |
Q |
96 |
ctgaaagtaaacacacaacttcagttgagtgtgttcttttagaccaaacccacatat-----ag-------atggattaccaatggttgaagatcatgtg |
183 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||| | ||||||| ||||||| || || ||||||||||||||||||||||||| |
|
|
T |
2970338 |
ctgaaagtaaacacacaacttcagttgagtgtgttatttgaaaccaaacacacatattctaaagttgatgtattaattaccaatggttgaagatcatgtg |
2970437 |
T |
 |
Q |
184 |
ttacaaggatattgtttggtcggacatctctgtgtattacgttatttttgtgcaagtata |
243 |
Q |
|
|
||||||||||||||||||||| ||||||||||||||||| |||||||||||||| ||||| |
|
|
T |
2970438 |
ttacaaggatattgtttggtctgacatctctgtgtattatgttatttttgtgcaggtata |
2970497 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University