View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0942_low_143 (Length: 244)
Name: NF0942_low_143
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0942_low_143 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 3 - 244
Target Start/End: Original strand, 36075554 - 36075789
Alignment:
| Q |
3 |
attatactgccaaagaaagttaaatgcctcataatctcaaccataataatgatgaaattgatgcttatttctgctggtcttggatttagaacctcaaaat |
102 |
Q |
| |
|
||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
36075554 |
attatactgccaaagaaagttaaatgccttat---ctcaaccataataatgatgaaattgatgctt---tctgctggtcttggatttagaacctcaaaat |
36075647 |
T |
|
| Q |
103 |
ttaagagaacttgatacatttctagccactggtcttggatttataagctcgatcttaagggatacatttcccacatacatacacaactgaacataaatct |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36075648 |
ttaagagaacttgatacatttctagccactggtcttggatttataagctcgatcttaacggatacatttcccacatacatacacaactgaacataaatct |
36075747 |
T |
|
| Q |
203 |
tcagttttttcacacaatctgaaaaattgaatagaatgactc |
244 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36075748 |
tcagttttttcacacaatctgaataattgaatagaatgactc |
36075789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University