View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0942_low_147 (Length: 234)
Name: NF0942_low_147
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0942_low_147 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 24 - 84
Target Start/End: Original strand, 48392048 - 48392108
Alignment:
| Q |
24 |
agcaaaattctttaatgctataacagtaatacactaatttaaatgcaaaaattgtgattgc |
84 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
48392048 |
agcaaaattctttaatgctataatagtaatacacaaatataaatgcaaaaattgtgattgc |
48392108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 106 - 144
Target Start/End: Original strand, 48392130 - 48392168
Alignment:
| Q |
106 |
atggaaatttaccttttagctacttggattgacttgatg |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48392130 |
atggaaatttaccttttagctacttggattgacttgatg |
48392168 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University