View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0942_low_151 (Length: 228)
Name: NF0942_low_151
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0942_low_151 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 8 - 228
Target Start/End: Complemental strand, 629812 - 629592
Alignment:
| Q |
8 |
cataatcaataatcaatttcaaagttgtattctctcaattgtataaaactagaaaaatggaatgatgttcactaattccttgcaaattccttcacggaat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
629812 |
cataatcaataatcaatttcaaagttgtattctctcaattgtataaaactagaaaaatggaatgatgttcactaattccttgcaaattccttcacggaat |
629713 |
T |
 |
| Q |
108 |
ttagtaataaaaaacttaaattcaacttagataggattcaaaacatgaggttgatgtcacaaattattttcctttatttctttaagaatatccatccttt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
629712 |
gtagtaataaaaaacttaaattcaacttagataggattcaaaacatgaggttgatgtcacaaattattttcctttatttctttaagaatatccatccttt |
629613 |
T |
 |
| Q |
208 |
ttcgaacatccaaatttcgaa |
228 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
629612 |
ttcgaacatccaaatttcgaa |
629592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University