View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0942_low_153 (Length: 228)
Name: NF0942_low_153
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0942_low_153 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 7 - 228
Target Start/End: Complemental strand, 36807424 - 36807203
Alignment:
| Q |
7 |
ggattaacataaactgcacaagcgagcaagacaccgcattttcacacttgtcacaccaagttagtagatgattattttgttgatcttttgactagatctc |
106 |
Q |
| |
|
|||||||| |||||||||||||||||||||| | | |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36807424 |
ggattaacttaaactgcacaagcgagcaagatatcacattttcacacttgtcacaccaagttagtagatgattattttgttgatcttttggctagatctc |
36807325 |
T |
 |
| Q |
107 |
tattatttctcaatattcgacagttagagagatacactcgtaaaatcaaggacccaaattatttgtagtcattttttcacgtaattgcacgcaatagttg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
36807324 |
tattatttctcaatattcgacagttagagagatacactcgtaaaatcaaggacccagattatttgtagtcgttttttcacgtaattgcacacaatagttg |
36807225 |
T |
 |
| Q |
207 |
atctcgacagttggtttaaggt |
228 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
36807224 |
atctcgacagttggtttaaggt |
36807203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University