View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0942_low_154 (Length: 225)
Name: NF0942_low_154
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0942_low_154 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 134 - 171
Target Start/End: Complemental strand, 44680372 - 44680335
Alignment:
| Q |
134 |
atgcttggaacatttctgctaaggtatctagagatgga |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44680372 |
atgcttggaacatttctgctaaggtatctagagatgga |
44680335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University