View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0942_low_156 (Length: 222)

Name: NF0942_low_156
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0942_low_156
NF0942_low_156
[»] chr4 (1 HSPs)
chr4 (1-125)||(9500605-9500729)


Alignment Details
Target: chr4 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 9500729 - 9500605
Alignment:
1 gccagtgatacatccaaacacagtatttatcaatgtagcaaataggttggagaacagaaaattcaactatggtcttccatacaccctagaacctagtcaa 100  Q
    ||||||||||| |||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9500729 gccagtgatacttccaaacatagtatttatcattgtagcaaataggttggagaacagaaaattcaactatggtcttccatacaccctagaacctagtcaa 9500630  T
101 gtttcactttagctgaagggtggag 125  Q
    |||||||||||||||||||||||||    
9500629 gtttcactttagctgaagggtggag 9500605  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University