View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0942_low_160 (Length: 217)
Name: NF0942_low_160
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0942_low_160 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 30 - 87
Target Start/End: Original strand, 9557344 - 9557401
Alignment:
Q |
30 |
cttctggtccctataagttattttgtttggattcggtcacggttatttttagtctctg |
87 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
9557344 |
cttctagtccctataagttattttgtttggattcggtcacggttgtttttagtctctg |
9557401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University