View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0942_low_170 (Length: 206)
Name: NF0942_low_170
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0942_low_170 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 44016780 - 44016985
Alignment:
| Q |
1 |
gagttgaccaaaagaaggtgggatagagccagagagattggttgaagagagattaagaagctgaagcattgttaaagaggatagttgagatggtaaagaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44016780 |
gagttgaccaaaagaaggtgggatagagccagagagattggttgaagagagattaagaagctgaagcattgttaaagaggatagttgagatggtaaagaa |
44016879 |
T |
 |
| Q |
101 |
gtgaggttgaggaaagtatcagggatagaaagggaaatcactctagattgtggtgaacaagttatgcctttccatgaacatggtgttgatgttgaagggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44016880 |
gtgaggttgaggaaagtatcagggatagaaagggaaatcactctagattgtggtgaacaagttatgcctttccatgaacatggtgttgatgttgaagggt |
44016979 |
T |
 |
| Q |
201 |
tccatg |
206 |
Q |
| |
|
|||||| |
|
|
| T |
44016980 |
tccatg |
44016985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University