View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0942_low_170 (Length: 206)

Name: NF0942_low_170
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0942_low_170
NF0942_low_170
[»] chr1 (1 HSPs)
chr1 (1-206)||(44016780-44016985)


Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 44016780 - 44016985
Alignment:
1 gagttgaccaaaagaaggtgggatagagccagagagattggttgaagagagattaagaagctgaagcattgttaaagaggatagttgagatggtaaagaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44016780 gagttgaccaaaagaaggtgggatagagccagagagattggttgaagagagattaagaagctgaagcattgttaaagaggatagttgagatggtaaagaa 44016879  T
101 gtgaggttgaggaaagtatcagggatagaaagggaaatcactctagattgtggtgaacaagttatgcctttccatgaacatggtgttgatgttgaagggt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44016880 gtgaggttgaggaaagtatcagggatagaaagggaaatcactctagattgtggtgaacaagttatgcctttccatgaacatggtgttgatgttgaagggt 44016979  T
201 tccatg 206  Q
    ||||||    
44016980 tccatg 44016985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University