View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0942_low_50 (Length: 404)
Name: NF0942_low_50
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0942_low_50 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 86; Significance: 5e-41; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 244 - 348
Target Start/End: Complemental strand, 35804256 - 35804149
Alignment:
| Q |
244 |
cattgatcttattttgagggtaagtctttgggtatggctttacagaattattatta---taatattatacaaagagctatagccactgatgcttggggga |
340 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35804256 |
cattgatcttattttgaaggtaagtctttgggtatggctttacagaattattattatattattattatacaaagagctatagccactgatgcttggggga |
35804157 |
T |
|
| Q |
341 |
ttgatagt |
348 |
Q |
| |
|
|||||||| |
|
|
| T |
35804156 |
ttgatagt |
35804149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 35804824 - 35804750
Alignment:
| Q |
1 |
ccgagaattcaaggatggactaataaattcatgt------tataaagggaataaaaattgttcccacgaaaaatt |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
35804824 |
ccgagaattcaaggatggactaataaattcatgtgtttgttataaagggaataaaaattgttcccacgaaaaatt |
35804750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University