View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0942_low_59 (Length: 369)
Name: NF0942_low_59
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0942_low_59 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 30 - 369
Target Start/End: Complemental strand, 45400803 - 45400462
Alignment:
| Q |
30 |
atccatgcactaaaaaatgaacatgtggcaatcaacttacatggtaggtgtcgtgaaacaaacaacaaatgattagttcagcttttattggatcttggga |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45400803 |
atccatgcactaaaaaatgaacatgtggcaatcaaattacatggtaggtgtcgtgaaacaaacaacaaatgattagttcagcttttattggatcttggga |
45400704 |
T |
 |
| Q |
130 |
tttccgattcaaatcactttttaatttaacattggaccgttcttgatgtcagaggggagatagtagtttgtgtatgtgtgttctgaaataacactagnnn |
229 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45400703 |
tttccgattcaattcactttttaatttaacattggaccgttcttgatgtcagaggggagatagtagtttgtgtatgtgtgttctgaaataacactagttt |
45400604 |
T |
 |
| Q |
230 |
nnnnnagaggtgaaattatactatagttgcttaatcacaaaaaatagtatataattgttatccatgagctta--acacaattgcgcagggcagggttgga |
327 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||| ||||| ||||||||||||||||| || |
|
|
| T |
45400603 |
tttttagaggtgaaattatactatagttgattaatcacaaaaaatagtatataattgttacccatgagcttaacacacagttgcgcagggcagggttcga |
45400504 |
T |
 |
| Q |
328 |
aatgtctataagtcatggaaacattacttatagtgccattcc |
369 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45400503 |
aatgtctataagtcatggaaacattacttatagtgccattcc |
45400462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University