View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0942_low_62 (Length: 366)
Name: NF0942_low_62
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0942_low_62 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 17 - 366
Target Start/End: Original strand, 2271799 - 2272148
Alignment:
| Q |
17 |
gtgagatgaattcaatgctgaaatttaagatgaatattgttcttctacagaggggattttacaccaactaaaatgttcataattaaagtagttacaatgt |
116 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2271799 |
gtgaaatgaattcaatgctgaaatttaagatgaatattgttcttctacagaggggattttacaccaactaaaatgttcataattaaagtagttacaatgt |
2271898 |
T |
 |
| Q |
117 |
tggtgtaatgtggtaagtaatgacttattatctcaagtttagaatcggtgcaaaaataatgtggtatgtaatgcttttgtatttactggcttcctgcgtt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2271899 |
tggtgtaatgtggtaagtaatgacttattatctcaagtttagaatcggtgcaaaaataatgtggtatgtaatgcttttgtatttactggcttcctgcgtt |
2271998 |
T |
 |
| Q |
217 |
tctggtttgattttatgggatgagggctgcttcctggtgttctcggtcgtctatgattttttgcaaactagttttgggcttatttttgctccctgaagcc |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2271999 |
tctggtttgattttatgggatgagggctgcttcctggtgttctcggtcgtctatgattttttgcaaactagttttgggcttatttttgctccctgaagcc |
2272098 |
T |
 |
| Q |
317 |
aattgtcctgcaattctgggggtggagggagggttggggagattaatatt |
366 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2272099 |
aattgtcctgcaattctgggggtggggggagggttggggagattaatatt |
2272148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University