View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0942_low_64 (Length: 362)
Name: NF0942_low_64
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0942_low_64 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 102 - 286
Target Start/End: Complemental strand, 27776429 - 27776244
Alignment:
Q |
102 |
atgttgatcctgttaaggagattaatccttggagtgatgaggttcatgaatttcctgttgatgtttcaaaatgatgttagtaacctacttgggctgacat |
201 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27776429 |
atgttgatcctgttaaggagattaatccttggagtgatgagcttcatgaatttcctgttgatgtttcaaaatgatgttagtaacctacttgggctgacat |
27776330 |
T |
 |
Q |
202 |
gatcatattgtcttgggacctgaaaatgtgctcctcctcaagatttctgattcaattcaccctgatgt-agtttgagtggtctctg |
286 |
Q |
|
|
||||||||||||||||||||||||| ||||||||||||||| |||||| ||| |||||||||||||| |||||||||||| |||| |
|
|
T |
27776329 |
gatcatattgtcttgggacctgaaagtgtgctcctcctcaaagtttctggttcgattcaccctgatgtcagtttgagtggtttctg |
27776244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000008; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 102 - 170
Target Start/End: Complemental strand, 19742790 - 19742722
Alignment:
Q |
102 |
atgttgatcctgttaaggagattaatccttggagtgatgaggttcatgaatttcctgttgatgtttcaa |
170 |
Q |
|
|
|||||||||| |||| ||||| |||||||||||||||||| | |||| ||||||||||||||||||| |
|
|
T |
19742790 |
atgttgatccaattaaagagatcaatccttggagtgatgagataaatgagtttcctgttgatgtttcaa |
19742722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 19797298 - 19797366
Alignment:
Q |
102 |
atgttgatcctgttaaggagattaatccttggagtgatgaggttcatgaatttcctgttgatgtttcaa |
170 |
Q |
|
|
|||||||||| |||| ||||| |||||||||||||||||| | |||| ||||||||||||||||||| |
|
|
T |
19797298 |
atgttgatccaattaaagagatcaatccttggagtgatgagataaatgagtttcctgttgatgtttcaa |
19797366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 102 - 170
Target Start/End: Complemental strand, 19539747 - 19539679
Alignment:
Q |
102 |
atgttgatcctgttaaggagattaatccttggagtgatgaggttcatgaatttcctgttgatgtttcaa |
170 |
Q |
|
|
|||||||||| |||| ||||| |||||||||||||||||| | ||| ||||||||||||||||||| |
|
|
T |
19539747 |
atgttgatccaattaaagagatcaatccttggagtgatgagataagtgagtttcctgttgatgtttcaa |
19539679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 102 - 170
Target Start/End: Complemental strand, 19671670 - 19671602
Alignment:
Q |
102 |
atgttgatcctgttaaggagattaatccttggagtgatgaggttcatgaatttcctgttgatgtttcaa |
170 |
Q |
|
|
|||||||||| |||| ||||| |||||||||||||||||| | ||| |||||| |||||||||||| |
|
|
T |
19671670 |
atgttgatccaattaaagagatcaatccttggagtgatgagataagtgagtttcctcttgatgtttcaa |
19671602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 188 - 248
Target Start/End: Original strand, 27445001 - 27445061
Alignment:
Q |
188 |
acttgggctgacatgatcatattgtcttgggacctgaaaatgtgctcctcctcaagatttc |
248 |
Q |
|
|
||||||| ||||||||| ||||| ||||||||| || | |||||||||||||||| |||| |
|
|
T |
27445001 |
acttgggttgacatgatggtattgacttgggaccagagagtgtgctcctcctcaaggtttc |
27445061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University