View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0942_low_71 (Length: 353)
Name: NF0942_low_71
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0942_low_71 |
 |  |
|
| [»] scaffold0449 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0449 (Bit Score: 83; Significance: 3e-39; HSPs: 3)
Name: scaffold0449
Description:
Target: scaffold0449; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 127 - 213
Target Start/End: Complemental strand, 7218 - 7132
Alignment:
| Q |
127 |
ttagagtcgttggttattgacaatttattttctacatgttttttaagtttttgtacaacgatgaaattttgtatgggtttattggtc |
213 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7218 |
ttagggtcgttggttattgacaatttattttctacatgttttttaagtttttgtacaacgatgaaattttgtatgggtttattggtc |
7132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0449; HSP #2
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 255 - 344
Target Start/End: Complemental strand, 7090 - 7004
Alignment:
| Q |
255 |
gatagcttgcatgcaatgcacactaattatattttatttgtaatatacaacactttgacaccacatgtgcagtgcaagtgtagtctctgc |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
7090 |
gatagcttgcatgcaatgcacactaattatattttatttgtaatat---acactttgacaccacatatgcagtgcaactgtagtctctgc |
7004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0449; HSP #3
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 9 - 59
Target Start/End: Complemental strand, 7693 - 7643
Alignment:
| Q |
9 |
aagaacattaggtatatatgtcctccaattttctgcttttcatatttcttc |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7693 |
aagaacattaggtatatatgtcctccaattttctgcttttcatatttcttc |
7643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University