View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0942_low_83 (Length: 326)
Name: NF0942_low_83
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0942_low_83 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 29 - 315
Target Start/End: Complemental strand, 2862717 - 2862410
Alignment:
| Q |
29 |
aacttactagaaattattgactgcgtgaatgcagaaaatccttgattttgatgaatccat------------ccgaaccacaacccaaaccaaaatgtct |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
2862717 |
aacttactagaaattattgactgcgtgaatgcagaaaatccctgattttgatgaatccattcggcactccatccgaaccaaaacccaaaccaaaatgtct |
2862618 |
T |
 |
| Q |
117 |
aggcaattaagggagtttcttcatccttagaggatttggtcttg---------gacaagaacccaaatccatcaccacaatcaagctccctcaatttcaa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2862617 |
aggcaattaagggagtttcttcatccttagaggatttagtcttgttggaattggacaagaacccaaatccatcaccacaatcaagctccctcaatttcaa |
2862518 |
T |
 |
| Q |
208 |
caaaaagtaaagtacaatcccaacaaaaaaccctaaagcagcactagacccagtcaaagaaacagcagcacaaacaaacataataaaagactcttgttta |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2862517 |
caaaaagtaaagtacaatcccaacaaaaaaccctaaagcagcactagacccagtcaaagaaacagcagcacaaacaaacataataaaagactcttgttta |
2862418 |
T |
 |
| Q |
308 |
ctattcat |
315 |
Q |
| |
|
|||||||| |
|
|
| T |
2862417 |
ctattcat |
2862410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University