View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0942_low_94 (Length: 302)
Name: NF0942_low_94
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0942_low_94 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 171; Significance: 7e-92; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 70 - 251
Target Start/End: Complemental strand, 6317983 - 6317801
Alignment:
| Q |
70 |
actcttaacctccataactttgtccactcccctggttttctcaagtttacataaatcatatgaccatatttcactgatcaagtttcctcttggaacaaca |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6317983 |
actcttaacctccataactttgtccactcccctggttttctcaagtttacataaatcatatgaccatatttcactgatcaagtttcctcttggaacaaca |
6317884 |
T |
 |
| Q |
170 |
acaccaaaaccag-atttagcttcactcattaatcaactcagttcttcatgatatcaaattggaagtttcctccaagaattat |
251 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6317883 |
acaccaaaaccagaatttagcttcactcattaatcaactcagttcttcatgatatcaaattggaagtttcctcgaagaattat |
6317801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 164 - 214
Target Start/End: Complemental strand, 6299993 - 6299943
Alignment:
| Q |
164 |
acaacaacaccaaaaccagatttagcttcactcattaatcaactcagttct |
214 |
Q |
| |
|
||||||||||||||||||||||||||||| || || |||||||||||||| |
|
|
| T |
6299993 |
acaacaacaccaaaaccagatttagcttctcttgttgatcaactcagttct |
6299943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University