View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0942_low_99 (Length: 296)
Name: NF0942_low_99
Description: NF0942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0942_low_99 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 5e-53; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 1 - 106
Target Start/End: Complemental strand, 6564894 - 6564789
Alignment:
| Q |
1 |
gagtacgcaagtttagactatggcatgaataatctttgaccagtctttacttatcatatccaaattacgagagtccatttcctcggggccgaagggtaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6564894 |
gagtacgcaagtttagactatggcatgaataatctttgaccagtctttacttatcatatccaaattacgagagtccatttcctcggggccgaagggtaag |
6564795 |
T |
|
| Q |
101 |
accaac |
106 |
Q |
| |
|
|||||| |
|
|
| T |
6564794 |
accaac |
6564789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 228 - 288
Target Start/End: Complemental strand, 6564655 - 6564595
Alignment:
| Q |
228 |
tagtttgccgttttttgaaggaagtttgattgattacctgaagagtggtgtgctctctgct |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6564655 |
tagtttgccgttttttgaaggaagtttgattgattacctgaagagtggtgtgctctctgct |
6564595 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 122 - 165
Target Start/End: Complemental strand, 6564761 - 6564718
Alignment:
| Q |
122 |
aaccttaaatggtcatttgtttcttaagaccttacaatcaaacc |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6564761 |
aaccttaaatggtcatttgtttcttaagaccttacaatcaaacc |
6564718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University