View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0943_high_12 (Length: 406)
Name: NF0943_high_12
Description: NF0943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0943_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 116 - 398
Target Start/End: Original strand, 54672447 - 54672727
Alignment:
| Q |
116 |
tgagcacgcaccaagaattgtatgctatcatacaatcactgcagcatgtgctcactctcttctgtcaatatctctactccactgtgtgtcccctcttctg |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54672447 |
tgagcacgcaccaagaattgtatgctatcatacaatcactgcagcatgtgctcactctcttctgtcaatatctctactccactgtgtgtcccctcttcta |
54672546 |
T |
 |
| Q |
216 |
aatattcaatagcatataatggcactggcagaagctaccacgtatattaattgttcatagcaaaacatccacaaatgttgattcactctttcttctctat |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54672547 |
aatattcaatagcatataatggcactggcagaagctaccacgtatattaattgttcatagcaaaacatccacaaatgttgattcactctttcttctctat |
54672646 |
T |
 |
| Q |
316 |
tttctaatttctaccactctaatgaatgagtcagatcagatctgcaaactcatatcctcctatttttggcacagtcctatgct |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
54672647 |
tttctaatttctaccactctaatgaatgagtcagatcagatctgcaaactc--atcctcctatttttggcacagtcctatgct |
54672727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University