View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0943_high_2 (Length: 735)
Name: NF0943_high_2
Description: NF0943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0943_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 1e-92; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 1e-92
Query Start/End: Original strand, 495 - 725
Target Start/End: Complemental strand, 42518545 - 42518315
Alignment:
| Q |
495 |
tcaagcaggtacacgtactttactttctcgctcacaagnnnnnnnnnnnnnnnnnntctagtagacactgatggtttttatacagcagctttaagctttt |
594 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42518545 |
tcaagcaggtacacgtactttactttctcgctcacaagacacacacacacacactctctagtagacactgatggtttttatacagcagctttaagctttt |
42518446 |
T |
 |
| Q |
595 |
ccactgtctctctctatgtctgaagtaaattcacaacgtgaagattcacgaagacagaacagaaacaacttttttagcagttaaattattaccacgttat |
694 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42518445 |
ccactgtctctctctatgtctgaagtaaattcacaacgtgaagattcacgaagacagaacagaaacaacttttttagcagttaaattattaccacgttat |
42518346 |
T |
 |
| Q |
695 |
ttgttatggacactttatttatttgcctttg |
725 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |
|
|
| T |
42518345 |
ttgttatggacactttatttatttgtctttg |
42518315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 108; E-Value: 7e-54
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 42519031 - 42518916
Alignment:
| Q |
1 |
tttccatcatcacctttgttaaaatccttatcatcttcttcatcactttcaataataaaactgttctctgctgctactgagttattcatcttcactcttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42519031 |
tttccatcatcacctttgttaaaatccttatcatcttcttcatcactttcaataataaaactgttctctgaagctactgagttattcatcttcactcttc |
42518932 |
T |
 |
| Q |
101 |
accaactattcacctt |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
42518931 |
accaactattcacctt |
42518916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 106; E-Value: 1e-52
Query Start/End: Original strand, 194 - 332
Target Start/End: Complemental strand, 42518838 - 42518708
Alignment:
| Q |
194 |
ccggatctggattaattggtatcgaaaatgcaaactgcatggtaatatggtatgaacttggaatttgaaagcttacatataaaatattttagctgagaaa |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42518838 |
ccggatctggattaattggtatcgaaaatgcaaactgcatggtt--------tgaacttggaatttgaaagcttacatataaaatattttagctgagaaa |
42518747 |
T |
 |
| Q |
294 |
ctctatgataaaatttcagctatgcatgcatagtttaac |
332 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42518746 |
ctctatgataaaatttcagctatgcatgcatagtttaac |
42518708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 405 - 437
Target Start/End: Complemental strand, 42518635 - 42518603
Alignment:
| Q |
405 |
ccatagcatgaacgacacttgtgctttttgttt |
437 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42518635 |
ccatagcatgaacgacacttgtgctttttgttt |
42518603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University