View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0943_high_31 (Length: 268)
Name: NF0943_high_31
Description: NF0943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0943_high_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 27 - 221
Target Start/End: Original strand, 19489263 - 19489457
Alignment:
| Q |
27 |
gatatgaacaacttctccactgtcatttctcttttcagacaaatggaatttcaaagaattcacccatccattgtcactttaagcatcttaatcaattgct |
126 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19489263 |
gataagaacaacttctccactgtcatttctcttttcagacaaatggaatttcaaagaattcacccatccattgtcactttaagcatcttaatcaattgct |
19489362 |
T |
 |
| Q |
127 |
attcacacctccgtcaaatgaagttcgccttctctcttttcggtaaaattctcaagatgggttgtcatcccgatgtcattatcttcaatacactt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19489363 |
attcacacctccgtcaaatgaagttcgctttctctcttttcggtaaaattctcaagatgggttgtcatcccgatgtcattatcttcaatacactt |
19489457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 189
Target Start/End: Original strand, 21455744 - 21455784
Alignment:
| Q |
149 |
gttcgccttctctcttttcggtaaaattctcaagatgggtt |
189 |
Q |
| |
|
||||||||||||| | |||||||||||| |||||||||||| |
|
|
| T |
21455744 |
gttcgccttctctatattcggtaaaattttcaagatgggtt |
21455784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University