View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0943_low_21 (Length: 328)
Name: NF0943_low_21
Description: NF0943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0943_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 50 - 282
Target Start/End: Original strand, 32017077 - 32017310
Alignment:
| Q |
50 |
gagatgaatgttgatgagattgaaggttttgccttgcctattttactagtggaattgggatcctgaagattgcttaagaaggtagtatttaaggggggag |
149 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32017077 |
gagatggatgttgatgagattgaaggttttgccttgcctattttacgagtggaattgggatcctgaagattgcttaagaaggtagtatttaaggggggag |
32017176 |
T |
 |
| Q |
150 |
ggtctgtgtttttcgagctgtgctctctgggttggttcacagcaggttttgttggtgttttcccctatgcggctgttctgctatctgtagtagtgctgct |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32017177 |
ggtctgtgtttttcgagctgtgctctctgggttggttcacagcaggttttgttggttttttcccctatgcggctgttctgctatctgtagtagtgctgct |
32017276 |
T |
 |
| Q |
250 |
gtctt-ggggggtgcggggagtgttgttttctgc |
282 |
Q |
| |
|
||||| ||||||||||||||||||||||| |||| |
|
|
| T |
32017277 |
gtcttgggggggtgcggggagtgttgtttactgc |
32017310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 228 - 273
Target Start/End: Original strand, 27659235 - 27659280
Alignment:
| Q |
228 |
tgctatctgtagtagtgctgctgtcttggggggtgcggggagtgtt |
273 |
Q |
| |
|
|||||||||||||||||||||| | || |||||||| ||||||||| |
|
|
| T |
27659235 |
tgctatctgtagtagtgctgctatattagggggtgcagggagtgtt |
27659280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 228 - 273
Target Start/End: Complemental strand, 37604853 - 37604808
Alignment:
| Q |
228 |
tgctatctgtagtagtgctgctgtcttggggggtgcggggagtgtt |
273 |
Q |
| |
|
||||||||||||||||||| || |||| |||||||| ||||||||| |
|
|
| T |
37604853 |
tgctatctgtagtagtgctactatcttagggggtgcagggagtgtt |
37604808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University