View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0943_low_3 (Length: 661)
Name: NF0943_low_3
Description: NF0943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0943_low_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 5e-98; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 5e-98
Query Start/End: Original strand, 58 - 335
Target Start/End: Complemental strand, 25544331 - 25544053
Alignment:
| Q |
58 |
caataatggtgtcaccattattttggaaattgaagcggtttttaacattgaatagtttcaacattgaactaatcaatgttaaaaagacttttcaacctcc |
157 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||| |||||||||||||||||||| |||||||||||| ||||||||||||| || |||||||||| |
|
|
| T |
25544331 |
caataatggagtcaccattattttggaaatggaagcgttttttaacattgaatagtttaaacattgaactattcaatgttaaaaaaacgattcaacctcc |
25544232 |
T |
 |
| Q |
158 |
acaataatgacaccattattgctcattccgcggccgagagcttgaaacacagacacatctttgagatatgaagctagacaacggtctaattcaaaggaga |
257 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25544231 |
acaataatgacaccattattgctcattcggcggccgagagcttgaaacacagacgcatcttcgagatatgaagctagacaacggtctaattcaaaggaga |
25544132 |
T |
 |
| Q |
258 |
tcttgctaatattgtnnnnnnnnnnntctctgcttagtatg-tttgcatttccaaaacgacaatattcgatttcgacaa |
335 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||||||||||||| || ||||||||||| |
|
|
| T |
25544131 |
tcttgctaatattgtaaaaaaaaaaacctctgcttagtatgttttgcatttccaaaacgacaatctttgatttcgacaa |
25544053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 376 - 414
Target Start/End: Complemental strand, 25544056 - 25544018
Alignment:
| Q |
376 |
acaagctcatataacatgaacgaatcgtagttggataga |
414 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25544056 |
acaagctcatataacatgaacgaatcgtagtcggataga |
25544018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University