View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0943_low_32 (Length: 302)
Name: NF0943_low_32
Description: NF0943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0943_low_32 |
 |  |
|
| [»] scaffold0667 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 81; Significance: 4e-38; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 17 - 97
Target Start/End: Original strand, 8646823 - 8646903
Alignment:
| Q |
17 |
ttatgagtcatgtgtttattcaaattcaatagaaggacaaatgagatgagaatgagttttgttaatcaaaggtttattatg |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8646823 |
ttatgagtcatgtgtttattcaaattcaatagaaggacaaatgagatgagaatgagttttgttaatcaaaggtttattatg |
8646903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 17 - 97
Target Start/End: Complemental strand, 8611827 - 8611747
Alignment:
| Q |
17 |
ttatgagtcatgtgtttattcaaattcaatagaaggacaaatgagatgagaatgagttttgttaatcaaaggtttattatg |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
8611827 |
ttatgagtcatgtgtttattcaaattcaatagaaggacaaatgagatgagaatgagttttgctaatcaaaggtttactatg |
8611747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 19 - 94
Target Start/End: Original strand, 8555695 - 8555770
Alignment:
| Q |
19 |
atgagtcatgtgtttattcaaattcaatagaaggacaaatgagatgagaatgagttttgttaatcaaaggtttatt |
94 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
8555695 |
atgagtcatgtgcctattcaaattcaaatgaaggacaaatgagatgagaatgagttttgctaatcaaagggttatt |
8555770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 19 - 94
Target Start/End: Complemental strand, 8557027 - 8556952
Alignment:
| Q |
19 |
atgagtcatgtgtttattcaaattcaatagaaggacaaatgagatgagaatgagttttgttaatcaaaggtttatt |
94 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||| ||||||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
8557027 |
atgagtcatgtgcctattcaaattcaaaagaaggataaatgagatgagaatgagttttgctaatcaaagatttatt |
8556952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 38 - 94
Target Start/End: Original strand, 8567241 - 8567297
Alignment:
| Q |
38 |
aaattcaatagaaggacaaatgagatgagaatgagttttgttaatcaaaggtttatt |
94 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
8567241 |
aaattaaaaagaaggacaaatgagatgagaatgagttttcctaatcaaagggttatt |
8567297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 25 - 88
Target Start/End: Original strand, 8588926 - 8588989
Alignment:
| Q |
25 |
catgtgtttattcaaattcaatagaaggacaaatgagatgagaatgagttttgttaatcaaagg |
88 |
Q |
| |
|
|||||| | |||||||||||| ||||| ||| |||||||||| |||||||||| |||| ||||| |
|
|
| T |
8588926 |
catgtgctaattcaaattcaaaagaagaacatatgagatgaggatgagttttggtaataaaagg |
8588989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 54; Significance: 5e-22; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 93 - 150
Target Start/End: Complemental strand, 9320426 - 9320369
Alignment:
| Q |
93 |
ttatgtacttggctcaccctaatggaaaaatgactttcattattgttctttcttttgc |
150 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9320426 |
ttatgtacttgcctcaccctaatggaaaaatgactttcattattgttctttcttttgc |
9320369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 93 - 157
Target Start/End: Complemental strand, 9328025 - 9327961
Alignment:
| Q |
93 |
ttatgtacttggctcaccctaatggaaaaatgactttcattattgttctttcttttgctaagtgt |
157 |
Q |
| |
|
||||||||||| |||||||||||| |||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
9328025 |
ttatgtacttgcctcaccctaatgaaaaaatcactttcattattgttctttcttttgataagtgt |
9327961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 209 - 298
Target Start/End: Complemental strand, 9327945 - 9327856
Alignment:
| Q |
209 |
tatcttgcacggatctttttctggttgatattaaattaactcattgacagtgcaattatatgcatatttggatattagtatatctttatg |
298 |
Q |
| |
|
||||||| ||| |||||||||| | |||| |||||||| |||||||||| ||| ||||||||||||||||||| || ||||| ||||||| |
|
|
| T |
9327945 |
tatcttgaacgtatctttttctagatgattttaaattacctcattgacattgccattatatgcatatttggatgtttgtatacctttatg |
9327856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0667 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0667
Description:
Target: scaffold0667; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 99 - 173
Target Start/End: Complemental strand, 3835 - 3761
Alignment:
| Q |
99 |
acttggctcaccctaatggaaaaatgactttcattattgttctttcttttgctaagtgtttttaccaaaaccttt |
173 |
Q |
| |
|
||||| |||| |||||||| ||||||||||| ||||||||| ||| |||||||| |||| ||||| ||||||||| |
|
|
| T |
3835 |
acttgcctcatcctaatggcaaaatgacttttattattgttgtttattttgctatgtgtgtttacaaaaaccttt |
3761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University