View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0943_low_38 (Length: 276)
Name: NF0943_low_38
Description: NF0943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0943_low_38 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 34 - 276
Target Start/End: Original strand, 35695092 - 35695334
Alignment:
| Q |
34 |
gagatgaaggtgtcgtcgttgattgcttcgttggttttgaagaacttgtactgggaagattgtgttatgaattgttggaataaggaattgagtgattgag |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35695092 |
gagatgaaggtgtcgtcgttgattgcttcgttggttttgaagaacttgtattgggaagattgtgttatgaattgttggaataaggaattgagtgattgag |
35695191 |
T |
|
| Q |
134 |
aataagattgatggttgaaggtttgagttgagcatgttttgtatactaatttgttgtaattggaaattggttcagaagaaggtaggaagagcaagaaagt |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35695192 |
aataagattgatggttgaaggtttgagttgagcatgttttgtatactaatttgttgtaattggaaattggttcagaagaaggtaggaagagcaagaaagt |
35695291 |
T |
|
| Q |
234 |
gtaactaatgaagaagatggtggtggaatattgggaaacattc |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35695292 |
gtaactaatgaagaagatggtggtggaatattgggaaacattc |
35695334 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University