View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0943_low_49 (Length: 260)
Name: NF0943_low_49
Description: NF0943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0943_low_49 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 81; Significance: 3e-38; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 160 - 248
Target Start/End: Complemental strand, 37809244 - 37809156
Alignment:
| Q |
160 |
cgttccacgtttggtgtttgacttattctttacaagagtcttttttatggtagtgtgccagtagttctttatctcgttatctgtgctcc |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
37809244 |
cgttccacgtttggtgtttgacttattctttacaagagtcttttttatggtggtgtgccagtagttctttatctcgttatctgttctcc |
37809156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 30 - 102
Target Start/End: Complemental strand, 37809374 - 37809302
Alignment:
| Q |
30 |
cacttgtagatggttgtgaagatggtggactcgtaatattgaaatcactgttgttctctaacatttctccaag |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37809374 |
cacttgtagatggttgtgaagatggtggactcgtaatattgaaatcactgttgttctctaacatttctccaag |
37809302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 30 - 70
Target Start/End: Complemental strand, 37793013 - 37792973
Alignment:
| Q |
30 |
cacttgtagatggttgtgaagatggtggactcgtaatattg |
70 |
Q |
| |
|
|||||| | |||||||||||||| ||||||||||||||||| |
|
|
| T |
37793013 |
cacttgaaaatggttgtgaagatagtggactcgtaatattg |
37792973 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University