View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0943_low_56 (Length: 249)
Name: NF0943_low_56
Description: NF0943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0943_low_56 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 14159856 - 14160073
Alignment:
| Q |
1 |
tttcagtttatgaataattttgaaatttggtaaatttagagactaatttatttgacttcatcaattcatttggatcgtatctgtttcgaatgaggcacaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14159856 |
tttcagtttatgaataattttgaaatttggtaaatttagagactaatttatttgacttcatcaattcatttggatcatatctgtttcgaatgaggcacaa |
14159955 |
T |
 |
| Q |
101 |
ttatcaagcttaagttcttaatttaatccttgtgtaagaaggtccannnnnnncaggttgaattctttgtcagattttagttgattgctatctcaattta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14159956 |
ttatcaagcttaagttcttaatttaatccttgtgtaagaaggtccatttttttcagtttgaattctttgtcagattttagttgattgctatctcaattta |
14160055 |
T |
 |
| Q |
201 |
tgttaccaaaagcattga |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
14160056 |
tgttaccaaaagcattga |
14160073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University