View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0943_low_62 (Length: 214)

Name: NF0943_low_62
Description: NF0943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0943_low_62
NF0943_low_62
[»] chr6 (2 HSPs)
chr6 (145-202)||(2106616-2106673)
chr6 (151-202)||(2098162-2098212)


Alignment Details
Target: chr6 (Bit Score: 58; Significance: 1e-24; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 145 - 202
Target Start/End: Complemental strand, 2106673 - 2106616
Alignment:
145 aagaaagggatagttccatagttgtttttaacaaagaaatcatgtcatcgcttagaat 202  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2106673 aagaaagggatagttccatagttgtttttaacaaagaaatcatgtcatcgcttagaat 2106616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 151 - 202
Target Start/End: Complemental strand, 2098212 - 2098162
Alignment:
151 gggatagttccatagttgtttttaacaaagaaatcatgtcatcgcttagaat 202  Q
    ||||||||||||| |||||||| |||||||||||| |||||||||| |||||    
2098212 gggatagttccatggttgtttt-aacaaagaaatcgtgtcatcgctcagaat 2098162  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University