View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0943_low_62 (Length: 214)
Name: NF0943_low_62
Description: NF0943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0943_low_62 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 58; Significance: 1e-24; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 145 - 202
Target Start/End: Complemental strand, 2106673 - 2106616
Alignment:
| Q |
145 |
aagaaagggatagttccatagttgtttttaacaaagaaatcatgtcatcgcttagaat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2106673 |
aagaaagggatagttccatagttgtttttaacaaagaaatcatgtcatcgcttagaat |
2106616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 151 - 202
Target Start/End: Complemental strand, 2098212 - 2098162
Alignment:
| Q |
151 |
gggatagttccatagttgtttttaacaaagaaatcatgtcatcgcttagaat |
202 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||| |||||||||| ||||| |
|
|
| T |
2098212 |
gggatagttccatggttgtttt-aacaaagaaatcgtgtcatcgctcagaat |
2098162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University