View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0944_high_16 (Length: 315)
Name: NF0944_high_16
Description: NF0944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0944_high_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 14 - 305
Target Start/End: Original strand, 36878638 - 36878930
Alignment:
| Q |
14 |
ataatcagttttacatttaggttatgtttagttagttttaggttagtgtgacgcatgtgttatggtatcttgattttggtttttggtgtgattagttact |
113 |
Q |
| |
|
||||||||||||| ||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36878638 |
ataatcagttttagatttaggttgtgattagttagttttaggttagtgtgacgcatgtgttatggtatcttgattttggtttttggtgtgattagttact |
36878737 |
T |
|
| Q |
114 |
agatgaaattaggaattaatttgtgnnnnnnnnnn-cttcatatagttcaaagagcttgcacaagcttatgaggttttgagtgatcctgagaagcgtgag |
212 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36878738 |
agatgaaattaggaattaatttgtgtttttttttttcttcatatagttcaaagagcttgcacaagcttatgaggttttgagtgatcctgagaagcgtgag |
36878837 |
T |
|
| Q |
213 |
gtatatgatcagtacggtgaagatgctcttaaggaaggaatgggtggtggtggcggtggccatgacccatttgatattttctcatccttcttt |
305 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
36878838 |
gtatatgatcagtatggtgaagatgctcttaaggaaggaatgggtggcggtggcggtggccatgacccatttgatatattctcatccttcttt |
36878930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 79; Significance: 6e-37; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 156 - 305
Target Start/End: Complemental strand, 17857651 - 17857499
Alignment:
| Q |
156 |
tagttcaaagagcttgcacaagcttatgaggttttgagtgatcctgagaagcgtgaggtatatgatcagtacggtgaagatgctcttaaggaaggaatgg |
255 |
Q |
| |
|
|||||||||||||| || ||||||||||||||| |||| |||||||||||||||||| ||||||| ||| ||||| |||||||||||||||||||||| |
|
|
| T |
17857651 |
tagttcaaagagctagcgcaagcttatgaggttctgagcgatcctgagaagcgtgagatatatgacacgtatggtgaggatgctcttaaggaaggaatgg |
17857552 |
T |
|
| Q |
256 |
gtggt---ggtggcggtggccatgacccatttgatattttctcatccttcttt |
305 |
Q |
| |
|
||||| ||||| |||||||||||||||||||| || ||||| || |||||| |
|
|
| T |
17857551 |
gtggtggaggtggtggtggccatgacccatttgacatcttctcgtctttcttt |
17857499 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University