View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0944_high_28 (Length: 252)
Name: NF0944_high_28
Description: NF0944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0944_high_28 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 69; Significance: 5e-31; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 39985161 - 39985093
Alignment:
| Q |
1 |
attcatcagcgtttgcatgattattggtttcaatcatcaccacctgtgacatatctgttgggcaacgta |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39985161 |
attcatcagcgtttgcatgattattggtttcaatcatcaccacctgtgacatatctgttgggcaacgta |
39985093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University