View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0944_low_19 (Length: 325)
Name: NF0944_low_19
Description: NF0944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0944_low_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 82 - 227
Target Start/End: Original strand, 3802708 - 3802853
Alignment:
| Q |
82 |
gagcagagaaaacgtagacgacaaggttaagagcacttaacgctgcgatgaggtagaaaaaccaatccatgtgcccatcattcaagttattcggtatcca |
181 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3802708 |
gagcacagaacacgtagacgacaaggttaagagcacttaacgctgcgatgaggtagaaaaaccaatccatgtgcccatcattcaagttattcggtatcca |
3802807 |
T |
|
| Q |
182 |
tcccggttcttcgcctttagcagtgattttcatcacggatttcacc |
227 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3802808 |
tcccagttcttcgcctttagtagtgattttcatcacggatttcacc |
3802853 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 82 - 227
Target Start/End: Complemental strand, 398076 - 397931
Alignment:
| Q |
82 |
gagcagagaaaacgtagacgacaaggttaagagcacttaacgctgcgatgaggtagaaaaaccaatccatgtgcccatcattcaagttattcggtatcca |
181 |
Q |
| |
|
||||| |||| || |||| |||||||| ||| ||||||| |||||| |||||||||||||||| |||||||||||| |||| ||||||||||| ||||| |
|
|
| T |
398076 |
gagcacagaacacatagatgacaaggtcaagggcacttagcgctgcaatgaggtagaaaaacctgtccatgtgcccaacatttaagttattcggaatcca |
397977 |
T |
|
| Q |
182 |
tcccggttcttcgcctttagcagtgattttcatcacggatttcacc |
227 |
Q |
| |
|
||| ||||| |||||| ||||||||| | ||||||| |||||||| |
|
|
| T |
397976 |
tccaggttcctcgcctctagcagtgaatatcatcaccaatttcacc |
397931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University