View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0944_low_23 (Length: 307)
Name: NF0944_low_23
Description: NF0944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0944_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 261; Significance: 1e-145; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 294
Target Start/End: Complemental strand, 9232009 - 9231716
Alignment:
Q |
1 |
tgttatgttgcgaattttgccgcaagatgaagttggacatggttggtgattcttagctagacaattttgatggaataggataaaaattgaagcaaatatt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9232009 |
tgttatgttgcgaattttgccgcaagatgaagttggacatggttggtgatgcttagctagacaattttgatggaataggataaaaattgaagcaaatatt |
9231910 |
T |
 |
Q |
101 |
tttaccaatgtttgtagttgtacaaatgatgaacaagaaaatcgagcttgtcttttcatcattcaagtcttcnnnnnnntatgaaattttttaaaacaag |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
9231909 |
tttaccaatgtttgtagttgtacaaatgatgaacaagaaaattgagcttgtcttttcatcattcaagtcttcaaaaaaatatgaaattttttaaaacaag |
9231810 |
T |
 |
Q |
201 |
ccctcatgagaaaatgttgtgattggtttatgtttttaaattttataaatgggtcaatcatttatcattaggttgccaccatatctagctgtct |
294 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9231809 |
ccctcatgagaaaatgttgtgattggtttatgttttttaattttataaatgggtcaatcatttatcattaggttgccaccatatctagctgtct |
9231716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 9386636 - 9386733
Alignment:
Q |
1 |
tgttatgttgcgaattttgccgcaagatgaagttggacatggttggtgattcttagctagacaattttgatggaataggataaaaattgaagcaaata |
98 |
Q |
|
|
|||||||||| ||||||||||| ||||| ||||| ||||||||||||| |||||| |||||||||||||| | | || || |||||||||||||| |
|
|
T |
9386636 |
tgttatgttggtgattttgccgcatgatgacgttgggcatggttggtgatgcttagcaagacaattttgatgagaaatgagaagaattgaagcaaata |
9386733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University