View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0944_low_28 (Length: 275)
Name: NF0944_low_28
Description: NF0944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0944_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 35 - 246
Target Start/End: Original strand, 37267548 - 37267765
Alignment:
| Q |
35 |
gaagaatatgaggtaagtggggtacaaaattcaacttccaacatactggacaagtggggac------gtggacgtgtagcagaaaacataggtgttggat |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37267548 |
gaagaatatgaggtaagtggggtacaaaattcaacttccaacatactggacaagtggggacgtggacgtggacgtgtagcagaaaacataggtgttggat |
37267647 |
T |
 |
| Q |
129 |
gtatgaaaaaacttcaacttccatcgtgaaaaggtttcaccatatagtaggtgattaacttatgtagggaaaattgtttgccaataaaatatggtataaa |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37267648 |
gtatgaaaaaacttcaacttccatcgtgaaaaggtttcaccatatagtaggtgattaacttatgtagggaaaattatttgccaataaaatatggtataaa |
37267747 |
T |
 |
| Q |
229 |
tatgtcttcatctcagtc |
246 |
Q |
| |
|
||| ||||||| |||||| |
|
|
| T |
37267748 |
tatatcttcatttcagtc |
37267765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University