View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0944_low_30 (Length: 271)

Name: NF0944_low_30
Description: NF0944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0944_low_30
NF0944_low_30
[»] chr4 (1 HSPs)
chr4 (37-172)||(34578263-34578398)


Alignment Details
Target: chr4 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 37 - 172
Target Start/End: Complemental strand, 34578398 - 34578263
Alignment:
37 gagggcattgttttagatgttacaccaagtgcaggcaagtcatttcacgaagatgtaaatagaaggaaggccatgtttcctgaaactggcatgtcagcaa 136  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34578398 gagggaattgttttagatgttacaccaagtgcaggcaagtcatttcacgaagatgtaaatagaaggaaggccatgtttcctgaaactggcatgtcagcaa 34578299  T
137 aaaatgttaatattttgaggtaaggctgctgccgct 172  Q
    ||||||||||||||||||||||||||||||||||||    
34578298 aaaatgttaatattttgaggtaaggctgctgccgct 34578263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University