View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0945_high_18 (Length: 381)
Name: NF0945_high_18
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0945_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 84 - 283
Target Start/End: Original strand, 14811748 - 14811947
Alignment:
Q |
84 |
taatttgtcatggcgtatcaactcacatctatgtcgagcaaaattagctcaatgctaccaacacaaccacggaaaaagctggtctcaacggaccacctac |
183 |
Q |
|
|
|||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| |||||||||||||||||| |
|
|
T |
14811748 |
taatttttcatggcgtatcagctcacatctatgtcgagcaaaattagctcaatgctaccaacacgaccatggaaaaagctgctctcaacggaccacctac |
14811847 |
T |
 |
Q |
184 |
gaaccaccctaaccttgatcttccagtccaccctaccagttgttagagagtgcaagtttatgaaaggcaacaccatttttctttagcacaatgttcttac |
283 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
14811848 |
aaaccaccctaaccttgatcttccagtccaccctaccagttgttagagagtgcaagtttgtgaaaggcaacaccatttttctttagcacaatgttcttac |
14811947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University