View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0945_high_23 (Length: 373)
Name: NF0945_high_23
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0945_high_23 |
 |  |
|
| [»] scaffold0274 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 134 - 359
Target Start/End: Original strand, 1219874 - 1220099
Alignment:
| Q |
134 |
aaagatgatccacatgcaaattggttaatgtcttgcgtggcactttagttaaagtctcacgtggaactccaattgaatcttcactaattgttccatcttt |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1219874 |
aaagatgatccacatgcaaattggttaatgtcttgcgtggcactttagttaaagtctcacgtggaactccaattgaatcttcactaattgttccatcttt |
1219973 |
T |
 |
| Q |
234 |
ttccatgccaggcacaacttgttgatcgccgtaaccctcatgaatggtttcaagtgcctctcccttgccatgattacgacttatttcaccaagtaccatt |
333 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1219974 |
ttccatgccaggcacaacttgttgatcaccgtaaccctcatgaatggtttcaagtgcctctcccttgccatgattacgacttatttcaccaagtaccatt |
1220073 |
T |
 |
| Q |
334 |
aaatcaacattattttcgatgtcgtt |
359 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
1220074 |
aaatcaacattattttcgatgtcgtt |
1220099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 246 - 339
Target Start/End: Complemental strand, 33362347 - 33362254
Alignment:
| Q |
246 |
cacaacttgttgatcgccgtaaccctcatgaatggtttcaagtgcctctcccttgccatgattacgacttatttcaccaagtaccattaaatca |
339 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| ||||| | | |||||| |||||||||||| || |||||||||| |
|
|
| T |
33362347 |
cacaacttgttgatcaccgtaaccctcatgaatggtttcaagtgccttccccttatgacgtttacgatttatttcaccaattatcattaaatca |
33362254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 134 - 206
Target Start/End: Complemental strand, 2004713 - 2004641
Alignment:
| Q |
134 |
aaagatgatccacatgcaaattggttaatgtcttgcgtggcactttagttaaagtctcacgtggaactccaat |
206 |
Q |
| |
|
||||||||||||||||||||| |||||||||| || ||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
2004713 |
aaagatgatccacatgcaaatccgttaatgtctcgcatggcactgcagttaaagtctcacgtggagctccaat |
2004641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 4e-17; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 246 - 339
Target Start/End: Complemental strand, 41441181 - 41441088
Alignment:
| Q |
246 |
cacaacttgttgatcgccgtaaccctcatgaatggtttcaagtgcctctcccttgccatgattacgacttatttcaccaagtaccattaaatca |
339 |
Q |
| |
|
||||||||||||||| | ||||||||| |||||| |||||| |||| ||||||| | | |||||||||||||| |||||||||||||||||| |
|
|
| T |
41441181 |
cacaacttgttgatcacaataaccctcacgaatggcttcaagagccttccccttgctacgtttacgacttatttctccaagtaccattaaatca |
41441088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 339
Target Start/End: Complemental strand, 41431095 - 41431025
Alignment:
| Q |
269 |
cctcatgaatggtttcaagtgcctctcccttgccatgattacgacttatttcaccaagtaccattaaatca |
339 |
Q |
| |
|
|||||||||||| |||||||| || ||||| | | ||||||||||||||||||| ||||||||||||| |
|
|
| T |
41431095 |
cctcatgaatggcttcaagtgtcttcccctttttacgtttacgacttatttcaccaattaccattaaatca |
41431025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0274 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0274
Description:
Target: scaffold0274; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 339
Target Start/End: Original strand, 13828 - 13898
Alignment:
| Q |
269 |
cctcatgaatggtttcaagtgcctctcccttgccatgattacgacttatttcaccaagtaccattaaatca |
339 |
Q |
| |
|
|||||||||||| |||||||| || ||||| | | ||||||||||||||||||| ||||||||||||| |
|
|
| T |
13828 |
cctcatgaatggcttcaagtgtcttcccctttttacgtttacgacttatttcaccaattaccattaaatca |
13898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University