View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0945_high_45 (Length: 261)
Name: NF0945_high_45
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0945_high_45 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 30 - 261
Target Start/End: Original strand, 5565934 - 5566165
Alignment:
| Q |
30 |
atgtcctgagagaatttcagtagaaaaatcttacataatatgttgagattttatacctatcttcggttagcctgttaaagaaatggccaacgatcgatgg |
129 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || |
|
|
| T |
5565934 |
atgtcttgagagaattttagtagaaaaatcttacataatatgttgagattttatacctatcttcggttagcctgttaaagaaatggccaacagtcgacgg |
5566033 |
T |
|
| Q |
130 |
gcaagttggccctgtcggagcaattaaataactgtttctttaattttattttttcaactgacacaannnnnnnnattggtaatttaattagtttggtatt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5566034 |
gcaagttggccctgtcggagcaattaaataactgcttctttaattttattttttcaactgacacaattttttttattggtaatttaattagtttggtatt |
5566133 |
T |
|
| Q |
230 |
tgaatataaagttcatttttcacttcgttgtt |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
5566134 |
tgaatataaagttcatttttcacttcgttgtt |
5566165 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University