View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0945_low_10 (Length: 513)
Name: NF0945_low_10
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0945_low_10 |
 |  |
|
[»] scaffold0211 (1 HSPs) |
 |  |  |
|
[»] scaffold0114 (1 HSPs) |
 |  |  |
|
[»] scaffold0284 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 177; Significance: 3e-95; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 177; E-Value: 3e-95
Query Start/End: Original strand, 146 - 421
Target Start/End: Complemental strand, 11582566 - 11582293
Alignment:
Q |
146 |
tttcacttcttattctaac---attagtggctacatgaagataggaagcagaagttgccaaagcataagatagaaatgctacatgctcacttctagtgac |
242 |
Q |
|
|
||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
11582566 |
tttcacttcttattctaacgtcattagtggctacatgaagaaaggaagcagaagttgccaaagcataagatagaaatgatacatgctcacttctagtgac |
11582467 |
T |
 |
Q |
243 |
cttaaaaacattgccatcgtggaagcaagccctctaaataatcacacatgtacttggtgatttgttggaaatctcagcaagctcaatggagagcaaagac |
342 |
Q |
|
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11582466 |
cttaaaaacattgcca----------------tctaaataatcacacatgtacttggtgatttgttggaaatctcagcaagctcaatggagagcaaagac |
11582383 |
T |
 |
Q |
343 |
tttccccttatcaaaatg-----------actcttaacaatttgaagctctcttttgatggaatgttgcattagtgtaaagtgggtgatt |
421 |
Q |
|
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11582382 |
tttccccttatcaaaatgtcaccacaatcactcttaacaatttgaagctctcttttgatggaatgttgcattagtgtaaagtgggtgatt |
11582293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 11 - 52
Target Start/End: Complemental strand, 41527205 - 41527164
Alignment:
Q |
11 |
aaccaacctttttaaacatatggtgtcttcatttgatattat |
52 |
Q |
|
|
|||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
41527205 |
aaccaacctttttaaatatatggtgtcttcatttgatattat |
41527164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 69; Significance: 1e-30; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 424 - 504
Target Start/End: Complemental strand, 21871417 - 21871337
Alignment:
Q |
424 |
tggaaatttgttgggaatttacagttgcttaatcttcttaatattgcttgggagggctgcatttgatttccccctctctgc |
504 |
Q |
|
|
|||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
T |
21871417 |
tggaaacttgctgggaatttacagttgcttaatcttcttaatattgcttgggagggctgcatttgttttccccctctctgc |
21871337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 9 - 53
Target Start/End: Original strand, 50241389 - 50241433
Alignment:
Q |
9 |
ttaaccaacctttttaaacatatggtgtcttcatttgatattatt |
53 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
50241389 |
ttaaccaacctttttaaacatatggtgtcttcatttgatattatt |
50241433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0211 (Bit Score: 44; Significance: 8e-16; HSPs: 1)
Name: scaffold0211
Description:
Target: scaffold0211; HSP #1
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 10 - 53
Target Start/End: Complemental strand, 18629 - 18586
Alignment:
Q |
10 |
taaccaacctttttaaacatatggtgtcttcatttgatattatt |
53 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
18629 |
taaccaacctttttaaacatatggtgtcttcatttgatattatt |
18586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 8e-16; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 10 - 53
Target Start/End: Original strand, 314233 - 314276
Alignment:
Q |
10 |
taaccaacctttttaaacatatggtgtcttcatttgatattatt |
53 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
314233 |
taaccaacctttttaaacatatggtgtcttcatttgatattatt |
314276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 10 - 53
Target Start/End: Original strand, 6554451 - 6554494
Alignment:
Q |
10 |
taaccaacctttttaaacatatggtgtcttcatttgatattatt |
53 |
Q |
|
|
|||| |||||||||||| |||||||||||||||||||||||||| |
|
|
T |
6554451 |
taactaacctttttaaatatatggtgtcttcatttgatattatt |
6554494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 8e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 10 - 53
Target Start/End: Complemental strand, 31966017 - 31965974
Alignment:
Q |
10 |
taaccaacctttttaaacatatggtgtcttcatttgatattatt |
53 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
31966017 |
taaccaacctttttaaacatatggtgtcttcatttgatattatt |
31965974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0114 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold0114
Description:
Target: scaffold0114; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 14 - 53
Target Start/End: Original strand, 36954 - 36993
Alignment:
Q |
14 |
caacctttttaaacatatggtgtcttcatttgatattatt |
53 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36954 |
caacctttttaaacatatggtgtcttcatttgatattatt |
36993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 10 - 53
Target Start/End: Complemental strand, 45918404 - 45918361
Alignment:
Q |
10 |
taaccaacctttttaaacatatggtgtcttcatttgatattatt |
53 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45918404 |
taactaacctttttaaacatatggtgtcttcatttgatattatt |
45918361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 11 - 53
Target Start/End: Original strand, 49881712 - 49881754
Alignment:
Q |
11 |
aaccaacctttttaaacatatggtgtcttcatttgatattatt |
53 |
Q |
|
|
|||||||| |||||||| ||||||||||||||||||||||||| |
|
|
T |
49881712 |
aaccaaccgttttaaacgtatggtgtcttcatttgatattatt |
49881754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 10 - 53
Target Start/End: Original strand, 9024862 - 9024905
Alignment:
Q |
10 |
taaccaacctttttaaacatatggtgtcttcatttgatattatt |
53 |
Q |
|
|
|||||||| |||||||||||||||||||||| |||||||||||| |
|
|
T |
9024862 |
taaccaacttttttaaacatatggtgtcttcgtttgatattatt |
9024905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0284 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0284
Description:
Target: scaffold0284; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 19 - 53
Target Start/End: Complemental strand, 996 - 962
Alignment:
Q |
19 |
tttttaaacatatggtgtcttcatttgatattatt |
53 |
Q |
|
|
||||||||||||||||||||| ||||||||||||| |
|
|
T |
996 |
tttttaaacatatggtgtcttgatttgatattatt |
962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University