View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0945_low_14 (Length: 489)
Name: NF0945_low_14
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0945_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 238; Significance: 1e-131; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 76 - 394
Target Start/End: Complemental strand, 8437894 - 8437570
Alignment:
Q |
76 |
atgaatgatactgttatttttgcaaggatgaatggtgatgagaatgatagttgtatgcagtttttgagggacatggaagttgttcaggttcctacttttt |
175 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8437894 |
atgaatgatactgttatttttgcaaggatgaatggtgatgagaatgatagttgtatgcagtttttgagggacatggaagttgttcaggttcctacttttt |
8437795 |
T |
 |
Q |
176 |
tgttcattagagatggtaagattgctggtaggtatgttggttcagggaaaggtgaactcattggtgaaattctcaggtaccaaggagttcgtgttactta |
275 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8437794 |
tgttcattagagatggtaagattgctggtaggtatgttggttcagggaaaggtgaactcattggtgaaattctcaggtaccaaggagttcgtgttactta |
8437695 |
T |
 |
Q |
276 |
tt------aaatcaaatcaattgcttgttcatgtttgtattgatcataaacnnnnnnnnnnnnnnnnnnnngttaaggatttgtctcactgatttcattt |
369 |
Q |
|
|
|| |||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
8437694 |
ttaaaatcaaatcaaatcaattgcttgttcatgtgtgtattgatcataaacatatttttgtgagatatatagttaaggatttgtctcactgatttcattt |
8437595 |
T |
 |
Q |
370 |
ttcgaaagatatatccttatctttt |
394 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
8437594 |
ttcgaaagatatatccttatctttt |
8437570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University