View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0945_low_17 (Length: 436)
Name: NF0945_low_17
Description: NF0945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0945_low_17 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 11 - 321
Target Start/End: Complemental strand, 46922461 - 46922151
Alignment:
Q |
11 |
cacagacaattaccttaacgctgagagaatagaagacaaattcatcagctgtagtgacattaaggtgcaagattgtgagacacaatccatgcaaactaga |
110 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46922461 |
cacagacaattaccttaacgctgagagaatagaagacaaattcatcagctgtagtgacattaaggtgcaagattgtgagacacaatccatgcaaactaga |
46922362 |
T |
 |
Q |
111 |
aaccatcttcaagagctgttttggtcttttctttgttcttattttgagatttgcatggctttcaaccattgtcacttcaatatcagcaatattgcgagat |
210 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
T |
46922361 |
aaccatcttcaagagctgttttggtcttttctttgttcttattttgagatttgcatggctttcaaccattgtaacttcaatatcagcaatattgcgagat |
46922262 |
T |
 |
Q |
211 |
tgaacctcaccacccatttttgtctcagaactctcacacacaccgtcacttgttgagtattgtggaaaggtaaaaaattcagaaaagggcttgtttttat |
310 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46922261 |
tgaacctcaccacccatttttgtctcagaactctcacacacaccgtcacttgttgagtattgtggaaaggtaaaaaattcagaaaagggcttgtttttat |
46922162 |
T |
 |
Q |
311 |
tttcaacaata |
321 |
Q |
|
|
||||||||||| |
|
|
T |
46922161 |
tttcaacaata |
46922151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 100 - 200
Target Start/End: Original strand, 36675815 - 36675915
Alignment:
Q |
100 |
tgcaaactagaaaccatcttcaagagctgttttggtcttttctttgttcttattttgagatttgcatggctttcaaccattgtcacttcaatatcagcaa |
199 |
Q |
|
|
||||||| ||| || || ||||||||||| ||||| || || ||| ||||||||| |||||||||||| |||| |||||||||||||| || ||||||| |
|
|
T |
36675815 |
tgcaaaccagatacaattttcaagagctgctttggcctctttcttgatcttattttaagatttgcatggttttccaccattgtcacttctatgtcagcaa |
36675914 |
T |
 |
Q |
200 |
t |
200 |
Q |
|
|
| |
|
|
T |
36675915 |
t |
36675915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University